Incidental Mutations

64 incidental mutations are currently displayed, and affect 64 genes.
9 are Possibly Damaging.
28 are Probably Damaging.
20 are Probably Benign.
6 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 64 of 64] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 344995 UTSW Abca12 1.000 R4615 G1 225 N 1 71330334 I363V T C missense Het probably benign 0.000 0.071 phenotype 09/25/2015
2 345020 UTSW Abcc9 0.097 R4615 G1 225 N 6 142689107 A144P C G missense Het possibly damaging 0.927 phenotype 09/25/2015
3 345041 UTSW Adgrv1 0.000 R4615 G1 194 N 13 81494569 C T splice site 5 bp Het probably null phenotype 09/25/2015
4 345027 UTSW Adprhl1 0.000 R4615 G1 225 N 8 13242250 A G critical splice donor site 2 bp Het probably null 0.542 phenotype 09/25/2015
5 345010 UTSW Angptl3 0.301 R4615 G1 225 N 4 99031361 E119D A T missense Het probably benign 0.031 phenotype 09/25/2015
6 345056 UTSW Atp8b1 0.000 R4615 G1 225 N 18 64553099 N671S T C missense Het probably null 0.000 phenotype 09/25/2015
7 345045 UTSW C9 0.000 R4615 G1 225 N 15 6491463 D51G A G missense Het probably damaging 0.991 0.042 phenotype 09/25/2015
8 345030 UTSW Carmil2 0.150 R4615 G1 225 N 8 105695074 D1019G A G missense Het possibly damaging 0.945 phenotype 09/25/2015
9 345028 UTSW Cdh8 0.000 R4615 G1 225 N 8 99279622 I111K A T missense Het probably damaging 0.998 phenotype 09/25/2015
10 345055 UTSW Cep120 0.670 R4615 G1 225 N 18 53714841 R649G T C missense Het probably damaging 1.000 phenotype 09/25/2015
11 345040 UTSW Clptm1l 0.000 R4615 G1 225 N 13 73607738 K158* A T nonsense Het probably null phenotype 09/25/2015
12 345029 UTSW Cmtm1 0.188 R4615 G1 146 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 0.044 09/25/2015
13 345015 UTSW Cnga1 0.291 R4615 G1 225 N 5 72604774 L466V A C missense Het probably damaging 1.000 phenotype 09/25/2015
14 345047 UTSW Cpsf1 0.969 R4615 G1 225 N 15 76596937 T1240A T C missense Het possibly damaging 0.880 phenotype 09/25/2015
15 344998 UTSW Cubn 1.000 R4615 G1 225 N 2 13428749 S1117P A G missense Het probably damaging 1.000 phenotype 09/25/2015
16 345022 UTSW Cyp2b9 0.209 R4615 G1 225 N 7 26201125 L396Q T A missense Het probably damaging 1.000 09/25/2015
17 345032 UTSW Cyp8b1 0.240 R4615 G1 225 N 9 121916098 L56* A T nonsense Het probably null phenotype 09/25/2015
18 345049 UTSW Dcbld2 0.000 R4615 G1 225 N 16 58456094 T458A A G missense Het probably benign 0.027 phenotype 09/25/2015
19 345037 UTSW Dio2 0.097 R4615 G1 225 N 12 90729821 P131Q G T missense Het probably damaging 1.000 phenotype 09/25/2015
20 345043 UTSW Dlg5 1.000 R4615 G1 211 N 14 24158168 Y990C T C missense Het probably damaging 1.000 phenotype 09/25/2015
21 345052 UTSW Dsc3 1.000 R4615 G1 225 N 18 19971488 D594G T C missense Het possibly damaging 0.665 phenotype 09/25/2015
22 345039 UTSW Dsp 1.000 R4615 G1 225 N 13 38191632 E1131G A G missense Het probably damaging 0.977 phenotype 09/25/2015
23 345031 UTSW Fdx1 1.000 R4615 G1 225 N 9 51948645 Y21* A T nonsense Het probably null phenotype 09/25/2015
24 345018 UTSW Gal3st4 0.067 R4615 G1 225 N 5 138266263 V158A A G missense Het probably damaging 0.974 phenotype 09/25/2015
25 345053 UTSW Gm10269 R4615 G1 225 N 18 20682763 E67D T A missense Het probably benign 0.001 09/25/2015
26 345007 UTSW Gm5773 0.936 R4615 G1 225 N 3 93774032 H337R A G missense Het probably benign 0.012 0.112 09/25/2015
27 345060 UTSW Gm7102 0.241 R4615 G1 225 N 19 61175926 G24R C T missense Het unknown 0.062 09/25/2015
28 345042 UTSW Gng2 0.160 R4615 G1 225 N 14 19891327 V16I C T missense Het possibly damaging 0.857 phenotype 09/25/2015
29 345046 UTSW Gpr20 0.000 R4615 G1 225 N 15 73695736 N268S T C missense Het probably benign 0.000 0.109 09/25/2015
30 345038 UTSW Ighv1-82 0.218 R4615 G1 225 N 12 115952660 T77A T C missense Het probably benign 0.057 0.124 09/25/2015
31 345034 UTSW Lama2 0.335 R4615 G1 225 N 10 26981524 V3110F C A missense Het probably damaging 0.991 phenotype 09/25/2015
32 500672 UTSW Mtmr4 0.235 R4615 G1 225 N 11 87610935 L548S T C missense Het probably damaging 0.992 0.190 12/01/2017
33 345014 UTSW Ncapg 0.949 R4615 G1 225 N 5 45687399 M579L A T missense Het probably benign 0.001 phenotype 09/25/2015
34 345011 UTSW Olfr1338 0.358 R4615 G1 225 N 4 118754137 T134A T C missense Het probably benign 0.337 phenotype 09/25/2015
35 345025 UTSW Olfr292 0.072 R4615 G1 225 N 7 86694728 S91P T C missense Het probably damaging 1.000 phenotype 09/25/2015
36 345012 UTSW Oog3 0.068 R4615 G1 225 N 4 144158329 Y346N A T missense Het probably benign 0.004 09/25/2015
37 345009 UTSW Orm2 0.051 R4615 G1 225 N 4 63363299 D89G A G missense Het probably damaging 0.993 09/25/2015
38 345054 UTSW Pcdhb4 0.064 R4615 G1 225 N 18 37308500 S288T T A missense Het probably benign 0.024 09/25/2015
39 345001 UTSW Pcsk2 0.349 R4615 G1 225 N 2 143795969 C375F G T missense Het probably damaging 1.000 phenotype 09/25/2015
40 345005 UTSW Pdcd10 1.000 R4615 G1 225 N 3 75521091 I138M T C missense Het probably damaging 1.000 phenotype 09/25/2015
41 345024 UTSW Pde8a 0.000 R4615 G1 225 N 7 81320737 W536R T C missense Het probably damaging 1.000 phenotype 09/25/2015
42 345026 UTSW Phkg2 0.464 R4615 G1 225 N 7 127577620 R61W C T missense Het probably damaging 0.999 0.194 phenotype 09/25/2015
43 344994 UTSW Plcl1 0.849 R4615 G1 225 N 1 55698134 N878I A T missense Het probably benign 0.003 phenotype 09/25/2015
44 345048 UTSW Prkdc 0.963 R4615 G1 225 N 16 15663074 D353V A T missense Het probably damaging 0.987 phenotype 09/25/2015
45 345035 UTSW Psme4 0.000 R4615 G1 225 N 11 30834287 T954I C T missense Het probably benign 0.021 phenotype 09/25/2015
46 345017 UTSW Ran R4615 G1 225 N 5 129022098 I115V A G missense Het probably benign 0.066 phenotype 09/25/2015
47 345013 UTSW Reln 0.947 R4615 G1 225 N 5 21972872 L1867P A G missense Het possibly damaging 0.954 phenotype 09/25/2015
48 345006 UTSW S100a1 R4615 G1 225 N 3 90511255 V84A A G missense Het possibly damaging 0.632 phenotype 09/25/2015
49 345044 UTSW Sall2 0.000 R4615 G1 225 N 14 52312750 P994L G A missense Het probably benign 0.202 phenotype 09/25/2015
50 345059 UTSW Shtn1 0.000 R4615 G1 225 N 19 59022216 I273N A T missense Het probably benign 0.184 09/25/2015
51 345004 UTSW Slc17a9 0.000 R4615 G1 225 N 2 180731906 I40T T C missense Het probably benign 0.000 phenotype 09/25/2015
52 345057 UTSW Slc29a2 0.252 R4615 G1 225 N 19 5029264 V305A T C missense Het probably damaging 0.983 phenotype 09/25/2015
53 345000 UTSW Ssfa2 0.550 R4615 G1 225 N 2 79662382 E1091G A G missense Het probably damaging 0.993 phenotype 09/25/2015
54 345033 UTSW Taar2 0.000 R4615 G1 225 N 10 23941365 F268I T A missense Het probably benign 0.430 09/25/2015
55 344997 UTSW Taf3 0.962 R4615 G1 225 N 2 9952090 T422I G A missense Het probably damaging 0.998 phenotype 09/25/2015
56 345008 UTSW Tgs1 1.000 R4615 G1 225 N 4 3585156 F99L T C missense Het probably damaging 1.000 phenotype 09/25/2015
57 345003 UTSW Tox2 0.000 R4615 G1 207 N 2 163320647 L479P T C missense Het probably damaging 1.000 0.222 09/25/2015
58 344999 UTSW Ttn 1.000 R4615 G1 225 N 2 76766875 I19898T A G missense Het probably damaging 0.996 phenotype 09/25/2015
59 345016 UTSW Ulk1 0.000 R4615 G1 225 N 5 110789046 T3N G T missense Het probably damaging 0.997 phenotype 09/25/2015
60 345050 UTSW Vars 0.968 R4615 G1 225 N 17 35013881 K900N A T missense Het probably damaging 0.968 phenotype 09/25/2015
61 500671 UTSW Vmn2r15 0.148 R4615 G1 225 N 5 109293482 V170A A G missense Het possibly damaging 0.907 12/01/2017
62 345021 UTSW Vmn2r53 0.108 R4615 G1 225 N 7 12582302 L530Q A T missense Het probably damaging 1.000 09/25/2015
63 345019 UTSW Zar1l 0.407 R4615 G1 225 N 5 150518063 Q33K G T missense Het probably benign 0.413 phenotype 09/25/2015
64 345058 UTSW Zdhhc16 0.530 R4615 G1 225 N 19 41943683 V358A T C missense Het possibly damaging 0.735 phenotype 09/25/2015
[records 1 to 64 of 64]