Incidental Mutations

77 incidental mutations are currently displayed, and affect 77 genes.
13 are Possibly Damaging.
25 are Probably Damaging.
29 are Probably Benign.
7 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 349304 UTSW 2010111I01Rik 0.188 R4632 G1 225 N 13 63068092 S393P T C missense Het probably benign 0.007 0.028 phenotype 10/08/2015
2 349318 UTSW Abcg1 0.425 R4632 G1 225 N 17 31064473 V44A T C missense Het probably benign 0.000 phenotype 10/08/2015
3 349295 UTSW Abr 0.409 R4632 G1 179 N 11 76509019 G39R C T missense Het probably benign 0.100 phenotype 10/08/2015
4 349294 UTSW Adora2b 0.000 R4632 G1 217 N 11 62265382 TGGACCACTCCAGGACCACTC TGGACCACTC frame shift Het probably null phenotype 10/08/2015
5 349275 UTSW Agbl1 0.096 R4632 G1 225 N 7 76413685 T47A A G missense Het probably benign 0.004 phenotype 10/08/2015
6 349274 UTSW Akap13 1.000 R4632 G1 225 N 7 75666553 A1389S G T missense Het possibly damaging 0.911 phenotype 10/08/2015
7 349268 UTSW Alkbh2 0.000 R4632 G1 225 N 5 114124226 E148K C T missense Het probably damaging 0.979 0.268 phenotype 10/08/2015
8 349241 UTSW Ankar 0.061 R4632 G1 225 N 1 72647184 T1286S T A missense Het probably benign 0.012 10/08/2015
9 349256 UTSW Ankrd13c 0.589 R4632 G1 225 N 3 157962302 H166R A G missense Het probably damaging 0.990 10/08/2015
10 349301 UTSW Arl16 0.191 R4632 G1 225 N 11 120465784 S130P A G missense Het probably damaging 0.997 phenotype 10/08/2015
11 349273 UTSW Atp10a 0.510 R4632 G1 225 N 7 58807438 Q895L A T missense Het possibly damaging 0.481 p23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators] (source: MGI)">phenotype 10/08/2015
12 500737 UTSW Atp13a5 0.192 R4632 G1 225 N 16 29348719 R138W T A missense Het probably damaging 1.000 phenotype 12/01/2017
13 349270 UTSW Auts2 0.423 R4632 G1 225 N 5 131472275 T309M G A missense Het probably damaging 1.000 phenotype 10/08/2015
14 349306 UTSW C6 0.400 R4632 G1 225 N 15 4759868 K265I A T missense Het probably benign 0.009 phenotype 10/08/2015
15 349261 UTSW Casz1 0.428 R4632 G1 225 N 4 148951855 T1525A A G missense Het possibly damaging 0.706 phenotype 10/08/2015
16 349265 UTSW Chpf2 0.119 R4632 G1 225 N 5 24591831 T592A A G missense Het probably benign 0.000 10/08/2015
17 349286 UTSW Cilp 0.034 R4632 G1 225 N 9 65279880 T1086S A T missense Het probably benign 0.174 0.072 phenotype 10/08/2015
18 349282 UTSW Cmip 0.946 R4632 G1 217 N 8 117447411 Y410C A G missense Het possibly damaging 0.878 phenotype 10/08/2015
19 349308 UTSW Csmd3 0.848 R4632 G1 225 N 15 48011209 C560R A G missense Het probably damaging 0.989 10/08/2015
20 349278 UTSW Dchs1 1.000 R4632 G1 225 N 7 105754355 E2993D T A missense Het probably benign 0.016 phenotype 10/08/2015
21 349240 UTSW Dnah7a 0.281 R4632 G1 225 N 1 53427951 F3585L A G missense Het probably damaging 0.974 10/08/2015
22 349267 UTSW Dspp 0.000 R4632 G1 187 N 5 104177406 D545G A G missense Het unknown phenotype 10/08/2015
23 349289 UTSW Dusp7 0.208 R4632 G1 225 N 9 106370766 S198T T A missense Het possibly damaging 0.638 phenotype 10/08/2015
24 349305 UTSW Ell2 0.409 R4632 G1 225 N 13 75769574 Q541L A T missense Het possibly damaging 0.841 10/08/2015
25 349263 UTSW Fzd1 0.000 R4632 G1 225 N 5 4755865 Y572* A T nonsense Het probably null 0.630 phenotype 10/08/2015
26 349280 UTSW Galntl6 0.125 R4632 G1 225 N 8 58427823 I99F T A missense Het probably damaging 0.998 10/08/2015
27 349313 UTSW Gm609 0.123 R4632 G1 225 N 16 45417908 H181P T G missense Het probably benign 0.337 10/08/2015
28 349264 UTSW Gnat3 0.000 R4632 G1 225 N 5 18015366 G A splice site 5 bp Het probably null phenotype 10/08/2015
29 349284 UTSW Hykk 0.109 R4632 G1 225 N 9 54946516 I374T T C missense Het probably benign 0.015 10/08/2015
30 349254 UTSW Kcnd3 0.000 R4632 G1 225 N 3 105658766 A421V C T missense Het probably damaging 1.000 0.354 phenotype 10/08/2015
31 349244 UTSW Kcnt2 0.406 R4632 G1 225 N 1 140523148 I722V A G missense Het possibly damaging 0.896 phenotype 10/08/2015
32 349311 UTSW Krt1 0.270 R4632 G1 178 N 15 101846187 G543S C T missense Het unknown 0.046 phenotype 10/08/2015
33 349299 UTSW Krt13 0.470 R4632 G1 225 N 11 100121224 L91P A G missense Het possibly damaging 0.956 phenotype 10/08/2015
34 349298 UTSW Krtap4-13 0.195 R4632 G1 143 N 11 99809528 S102A A C missense Het unknown 10/08/2015
35 349252 UTSW Lrp2 1.000 R4632 G1 225 N 2 69489129 A G splice site 6 bp Het probably null phenotype 10/08/2015
36 349292 UTSW Lrriq1 0.118 R4632 G1 225 N 10 103221427 V171I C T missense Het probably damaging 1.000 10/08/2015
37 349314 UTSW Map3k4 0.825 R4632 G1 225 N 17 12232504 E1501Q C G missense Het probably damaging 1.000 phenotype 10/08/2015
38 349310 UTSW Mapk11 0.000 R4632 G1 225 N 15 89146376 V105M C T missense Het probably damaging 1.000 phenotype 10/08/2015
39 349242 UTSW Mlph 0.173 R4632 G1 225 N 1 90939386 A377T G A missense Het probably damaging 0.986 phenotype 10/08/2015
40 349285 UTSW Myo9a 0.362 R4632 G1 225 N 9 59869664 C1115Y G A missense Het probably benign 0.005 phenotype 10/08/2015
41 349239 UTSW Nabp1 0.174 R4632 G1 225 N 1 51474602 Y78* A T nonsense Het probably null phenotype 10/08/2015
42 349296 UTSW Nos2 0.183 R4632 G1 225 N 11 78957591 F1108S T C missense Het possibly damaging 0.955 phenotype 10/08/2015
43 349269 UTSW Oas2 0.169 R4632 G1 225 N 5 120733481 K699R T C missense Het probably benign 0.337 phenotype 10/08/2015
44 349277 UTSW Olfm5 0.057 R4632 G1 225 N 7 104160893 D87G T C missense Het probably benign 0.003 10/08/2015
45 349312 UTSW Olfr15 0.155 R4632 G1 225 N 16 3839087 T38M C T missense Het probably damaging 1.000 phenotype 10/08/2015
46 349260 UTSW Oog3 0.040 R4632 G1 225 N 4 144158128 F413L A G missense Het probably benign 0.003 10/08/2015
47 349288 UTSW Pik3r4 1.000 R4632 G1 225 N 9 105654899 M557V A G missense Het probably benign 0.058 0.044 phenotype 10/08/2015
48 349307 UTSW Pkhd1l1 0.234 R4632 G1 225 N 15 44484400 T224A A G missense Het probably benign 0.072 10/08/2015
49 349283 UTSW Pknox2 0.400 R4632 G1 225 N 9 36894413 S367P A G missense Het probably benign 0.003 phenotype 10/08/2015
50 349293 UTSW Ppfia2 0.201 R4632 G1 225 N 10 106836044 A G splice site Het probably null phenotype 10/08/2015
51 349297 UTSW Ppm1e 0.337 R4632 G1 225 N 11 87231530 P534S G A missense Het probably damaging 1.000 phenotype 10/08/2015
52 349319 UTSW Prepl 0.360 R4632 G1 225 N 17 85083231 T100A T C missense Het probably benign 0.001 0.188 phenotype 10/08/2015
53 349266 UTSW Ptpn13 0.292 R4632 G1 225 N 5 103569860 N1924S A G missense Het possibly damaging 0.458 phenotype 10/08/2015
54 349276 UTSW Rsf1 0.597 R4632 G1 214 N 7 97579904 ATGGCG ATGGCGACGGTGGCG unclassified Het probably benign phenotype 10/08/2015
55 349309 UTSW Samd12 0.197 R4632 G1 225 N 15 53719671 H89L T A missense Het possibly damaging 0.899 10/08/2015
56 349248 UTSW Sephs1 0.814 R4632 G1 225 N 2 4896760 V211E T A missense Het probably benign 0.040 phenotype 10/08/2015
57 349249 UTSW Setx 0.000 R4632 G1 225 N 2 29148615 T1704I C T missense Het probably benign 0.233 phenotype 10/08/2015
58 349287 UTSW Sltm 0.844 R4632 G1 225 N 9 70579369 S439P T C missense Het possibly damaging 0.858 10/08/2015
59 349255 UTSW Sort1 0.632 R4632 G1 225 N 3 108346678 Q553H G T missense Het probably damaging 0.999 phenotype 10/08/2015
60 349253 UTSW Svs2 0.000 R4632 G1 225 N 2 164237747 T80N G T missense Het probably benign 0.399 phenotype 10/08/2015
61 349251 UTSW Tanc1 0.227 R4632 G1 225 N 2 59795835 T512K C A missense Het probably damaging 1.000 phenotype 10/08/2015
62 349271 UTSW Tas2r139 0.048 R4632 G1 225 N 6 42141498 V188E T A missense Het probably damaging 1.000 phenotype 10/08/2015
63 349259 UTSW Tesk2 0.293 R4632 G1 225 N 4 116741712 R6W C T missense Het probably benign 0.015 phenotype 10/08/2015
64 349272 UTSW Tex101 0.000 R4632 G1 225 N 7 24668368 C186* G T nonsense Het probably null phenotype 10/08/2015
65 349300 UTSW Timp2 0.000 R4632 G1 225 N 11 118303772 S197N C T missense Het probably benign 0.001 phenotype 10/08/2015
66 349243 UTSW Tmem37 0.150 R4632 G1 225 N 1 120068249 C33S A T missense Het probably damaging 0.997 10/08/2015
67 349258 UTSW Tmem69 0.185 R4632 G1 225 N 4 116553038 D245G T C missense Het probably benign 0.000 10/08/2015
68 349290 UTSW Trak1 0.230 R4632 G1 225 N 9 121454425 R419Q G A missense Het probably benign 0.017 0.058 phenotype 10/08/2015
69 349262 UTSW Ube2j2 0.171 R4632 G1 225 N 4 155955258 I14N T A missense Het probably damaging 0.982 0.228 phenotype 10/08/2015
70 349247 UTSW Ush2a 0.491 R4632 G1 225 N 1 188395874 N694K T A missense Het possibly damaging 0.820 phenotype 10/08/2015
71 349291 UTSW Utp20 0.979 R4632 G1 205 N 10 88778261 V1277A A G missense Het probably damaging 1.000 phenotype 10/08/2015
72 349315 UTSW Vmn2r100 0.068 R4632 G1 225 N 17 19531954 S753F C T missense Het probably damaging 1.000 10/08/2015
73 349316 UTSW Vmn2r103 0.074 R4632 G1 225 N 17 19793696 I250T T C missense Het probably benign 0.042 0.118 10/08/2015
74 349238 UTSW Zap70 0.340 R4632 G1 225 N 1 36778458 A261S G T missense Het probably benign 0.000 phenotype 10/08/2015
75 349320 UTSW Zdhhc6 0.000 R4632 G1 225 N 19 55314309 W87R A G missense Het probably damaging 1.000 10/08/2015
76 349303 UTSW Zfp410 0.309 R4632 G1 225 N 12 84325736 D112V A T missense Het probably damaging 1.000 0.348 10/08/2015
77 349257 UTSW Zfp462 0.416 R4632 G1 225 N 4 55012981 F501S T C missense Het probably damaging 1.000 phenotype 10/08/2015
[records 1 to 77 of 77]