Incidental Mutations

116 incidental mutations are currently displayed, and affect 114 genes.
19 are Possibly Damaging.
42 are Probably Damaging.
43 are Probably Benign.
11 are Probably Null.
4 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 116] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 357597 UTSW 9130023H24Rik 0.109 R4751 G1 225 Y 7 128237086 C112S A T missense Het probably benign 0.002 0.093 11/11/2015
2 357614 UTSW Abca13 0.000 R4751 G1 225 Y 11 9277973 G A critical splice donor site 1 bp Het probably null 0.500 phenotype 11/11/2015
3 357593 UTSW Abca14 0.000 R4751 G1 225 Y 7 120312177 E1328G A G missense Het probably benign 0.015 0.103 11/11/2015
4 357623 UTSW Abca9 0.000 R4751 G1 225 Y 11 110130570 I1105F T A missense Het probably benign 0.001 0.032 phenotype 11/11/2015
5 357616 UTSW Abr 0.388 R4751 G1 225 Y 11 76456608 N396D T C missense Het possibly damaging 0.786 0.168 phenotype 11/11/2015
6 357615 UTSW Aftph 0.750 R4751 G1 225 Y 11 20727074 C178W A C missense Het probably damaging 1.000 0.240 11/11/2015
7 357628 UTSW Akr1c14 0.000 R4751 G1 225 Y 13 4065338 F89S T C missense Het possibly damaging 0.608 0.078 11/11/2015
8 357610 UTSW Ank3 0.863 R4751 G1 225 Y 10 69986206 A1518V C T missense Het probably benign 0.185 0.104 phenotype 11/11/2015
9 357554 UTSW Arfgap2 0.902 R4751 G1 225 Y 2 91267368 S143R T G missense Het probably benign 0.099 0.130 phenotype 11/11/2015
10 357589 UTSW Aspdh 0.073 R4751 G1 225 Y 7 44467205 C107* T A nonsense Het probably null 0.620 11/11/2015
11 357577 UTSW Asphd2 0.297 R4751 G1 225 Y 5 112391746 G74W C A missense Het probably damaging 0.995 0.230 11/11/2015
12 357570 UTSW AU040320 0.000 R4751 G1 225 N 4 126854466 G A splice site 5 bp Het probably null phenotype 11/11/2015
13 357581 UTSW B3glct 0.200 R4751 G1 225 N 5 149725402 T A splice site Het probably null phenotype 11/11/2015
14 357604 UTSW Bcl9l 0.000 R4751 G1 225 Y 9 44506803 K646R A G missense Het probably damaging 0.987 0.092 phenotype 11/11/2015
15 357580 UTSW Brat1 0.173 R4751 G1 225 Y 5 140718296 L768R T G missense Het probably damaging 1.000 0.194 phenotype 11/11/2015
16 357551 UTSW Btbd18 0.179 R4751 G1 225 Y 2 84667921 Y634* T A nonsense Het probably null 0.700 phenotype 11/11/2015
17 357556 UTSW Bub1 1.000 R4751 G1 225 Y 2 127823938 T A intron Het probably benign phenotype 11/11/2015
18 357648 UTSW Carns1 0.121 R4751 G1 225 Y 19 4166418 D588E A T missense Het probably damaging 0.998 0.138 phenotype 11/11/2015
19 357633 UTSW Cast 0.000 R4751 G1 225 Y 13 74746047 K141E T C missense Het probably damaging 0.998 0.168 phenotype 11/11/2015
20 397143 UTSW Cd109 0.000 R4751 G1 174 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 06/24/2016
21 357646 UTSW Chsy3 0.000 R4751 G1 81 Y 18 59175800 S42P T C missense Het possibly damaging 0.662 0.198 phenotype 11/11/2015
22 357565 UTSW Clca1 0.106 R4751 G1 225 Y 3 145004848 F865I A T missense Het possibly damaging 0.894 0.088 phenotype 11/11/2015
23 357585 UTSW Clec4f 0.067 R4751 G1 225 Y 6 83645282 M526L T A missense Het possibly damaging 0.553 0.096 phenotype 11/11/2015
24 357574 UTSW Clnk 0.057 R4751 G1 225 Y 5 38720913 E301G T C missense Het probably benign 0.058 0.120 phenotype 11/11/2015
25 357543 UTSW Colgalt2 0.075 R4751 G1 225 Y 1 152489876 I309N T A missense Het probably benign 0.342 0.076 11/11/2015
26 357598 UTSW Cyp2e1 0.000 R4751 G1 225 Y 7 140774716 K326* A T nonsense Het probably null 0.590 phenotype 11/11/2015
27 357651 UTSW Dagla 0.000 R4751 G1 225 Y 19 10250394 T717S T A missense Het probably benign 0.002 0.129 phenotype 11/11/2015
28 357572 UTSW Dnajc11 0.934 R4751 G1 225 Y 4 151968542 R141H G A missense Het probably benign 0.010 0.250 phenotype 11/11/2015
29 357537 UTSW Dst 0.330 R4751 G1 225 Y 1 34191884 K2853E A G missense Het probably benign 0.210 0.138 phenotype 11/11/2015
30 397147 UTSW Eif4g1 0.965 R4751 G1 225 Y 16 20686515 K1208E A G missense Het possibly damaging 0.895 0.346 phenotype 06/24/2016
31 357612 UTSW Elane 0.061 R4751 G1 184 Y 10 79886791 R48G A G missense Het probably benign 0.002 0.083 phenotype 11/11/2015
32 357608 UTSW Fbxo30 0.172 R4751 G1 225 Y 10 11290195 N220K T A missense Het probably benign 0.009 0.070 phenotype 11/11/2015
33 357625 UTSW Fbxo33 0.000 R4751 G1 225 Y 12 59200928 A T intron Het probably benign phenotype 11/11/2015
34 357639 UTSW Fetub 0.066 R4751 G1 225 Y 16 22937895 V169I G A missense Het probably benign 0.018 0.124 phenotype 11/11/2015
35 357553 UTSW Gm13762 0.056 R4751 G1 225 Y 2 88973133 C253R A G missense Het probably damaging 1.000 0.504 11/11/2015
36 357573 UTSW Gm5861 0.226 R4751 G1 225 Y 5 11186491 Y138N T A missense Het probably damaging 0.988 0.045 11/11/2015
37 357631 UTSW Gpx6 0.000 R4751 G1 225 Y 13 21317064 Q107H A C missense Het probably damaging 0.998 0.474 phenotype 11/11/2015
38 357563 UTSW Hist2h2bb 0.235 R4751 G1 225 Y 3 96269151 A T unclassified Het probably benign 0.088 phenotype 11/11/2015
39 357601 UTSW Homer3 0.155 R4751 G1 225 Y 8 70285434 I19F A T missense Het probably damaging 1.000 0.386 phenotype 11/11/2015
40 397145 UTSW Hspa4 0.883 R4751 G1 225 Y 11 53284199 V144I C T missense Het probably benign 0.220 0.234 phenotype 06/24/2016
41 357538 UTSW Icos 0.129 R4751 G1 225 Y 1 60993717 S25L C T missense Het probably benign 0.009 0.130 phenotype 11/11/2015
42 357567 UTSW Ifna4 0.075 R4751 G1 225 Y 4 88841948 T30A A G missense Het probably benign 0.042 0.113 11/11/2015
43 357584 UTSW Ino80b 1.000 R4751 G1 225 Y 6 83124750 G46D C T missense Het probably damaging 0.993 0.176 phenotype 11/11/2015
44 357622 UTSW Kpna2 0.935 R4751 G1 225 Y 11 106992664 I100L T G missense Het possibly damaging 0.848 0.404 phenotype 11/11/2015
45 357638 UTSW Krt71 0.131 R4751 G1 202 Y 15 101735466 G446R C T missense Het probably damaging 1.000 0.330 phenotype 11/11/2015
46 357619 UTSW Krtap31-2 0.080 R4751 G1 194 N 11 99936576 N78S A G missense Het possibly damaging 0.707 11/11/2015
47 357647 UTSW Lman1 0.800 R4751 G1 225 Y 18 65998434 S132P A G missense Het probably benign 0.059 0.114 phenotype 11/11/2015
48 357562 UTSW Lmna 1.000 R4751 G1 225 Y 3 88486533 Q246R T C missense Het possibly damaging 0.869 0.076 phenotype 11/11/2015
49 357635 UTSW Lrp10 0.000 R4751 G1 128 Y 14 54468592 V413E T A missense Het probably damaging 0.999 0.412 phenotype 11/11/2015
50 357569 UTSW Macf1 1.000 R4751 G1 225 Y 4 123471650 I1541S A C missense Het probably benign 0.013 0.113 phenotype 11/11/2015
51 357618 UTSW Med24 1.000 R4751 G1 180 Y 11 98706432 L874P A G missense Het probably damaging 0.979 0.026 phenotype 11/11/2015
52 357586 UTSW Mgll 0.135 R4751 G1 152 Y 6 88725111 T A utr 5 prime Het probably benign 0.052 phenotype 11/11/2015
53 357568 UTSW Mrpl37 0.947 R4751 G1 225 Y 4 107057475 L364Q A T missense Het probably damaging 1.000 0.304 phenotype 11/11/2015
54 357559 UTSW Mrpl47 1.000 R4751 G1 225 Y 3 32728441 R209H C T missense Het probably benign 0.000 0.126 phenotype 11/11/2015
55 357599 UTSW Muc5ac 0.000 R4751 G1 225 Y 7 141817601 F3285L T C missense Het probably benign 0.005 0.123 phenotype 11/11/2015
56 357641 UTSW Mylk 0.000 R4751 G1 225 Y 16 34879169 R301G A G missense Het probably benign 0.287 0.088 phenotype 11/11/2015
57 397144 UTSW Nacad 0.000 R4751 G1 74 Y 11 6605726 L8P A G missense Het unknown 0.074 06/24/2016
58 357578 UTSW Ncf1 0.000 R4751 G1 225 Y 5 134229545 H8L T A missense Het probably damaging 1.000 0.370 phenotype 11/11/2015
59 357558 UTSW Ncoa3 0.949 R4751 G1 225 Y 2 166069903 M1383K T A missense Het possibly damaging 0.811 0.288 phenotype 11/11/2015
60 357603 UTSW Necab2 0.000 R4751 G1 225 N 8 119467598 S271L C T missense Het probably benign 0.001 phenotype 11/11/2015
61 357630 UTSW Nme8 0.112 R4751 G1 225 Y 13 19675638 A T critical splice donor site 2 bp Het probably null 0.617 phenotype 11/11/2015
62 357617 UTSW Nsrp1 1.000 R4751 G1 225 Y 11 77076719 T16P T G missense Het possibly damaging 0.691 0.026 phenotype 11/11/2015
63 357587 UTSW Obox3 0.131 R4751 G1 88 Y 7 15625692 A T critical splice donor site 2 bp Het probably null 0.595 11/11/2015
64 357552 UTSW Olfr1211 0.068 R4751 G1 225 Y 2 88929914 I134F T A missense Het probably damaging 0.999 0.246 phenotype 11/11/2015
65 357540 UTSW Olfr1416 0.097 R4751 G1 225 Y 1 92479983 A213S C A missense Het probably benign 0.013 0.184 phenotype 11/11/2015
66 357652 UTSW Olfr1428 0.155 R4751 G1 225 Y 19 12109177 Y123F T A missense Het probably damaging 0.999 0.102 phenotype 11/11/2015
67 357548 UTSW Olfr355 0.241 R4751 G1 225 Y 2 36927583 H177R T C missense Het probably damaging 0.996 0.448 phenotype 11/11/2015
68 357592 UTSW Olfr667 0.665 R4751 G1 225 Y 7 104916410 Y295* A T nonsense Het probably null 0.698 phenotype 11/11/2015
69 357583 UTSW Osbpl3 0.000 R4751 G1 168 Y 6 50300997 E790Q C G missense Het possibly damaging 0.947 0.240 phenotype 11/11/2015
70 357637 UTSW Osmr 0.066 R4751 G1 225 Y 15 6842852 W254R A T missense Het probably damaging 1.000 0.074 phenotype 11/11/2015
71 357594 UTSW Otoa 0.000 R4751 G1 225 Y 7 121132924 T C critical splice donor site Het probably benign 0.322 phenotype 11/11/2015
72 357595 UTSW Pagr1a 0.775 R4751 G1 225 Y 7 127015379 L218H A T missense Het probably damaging 1.000 0.196 phenotype 11/11/2015
73 357645 UTSW Pcdha11 0.237 R4751 G1 225 Y 18 37006944 G542D G A missense Het probably damaging 1.000 0.027 phenotype 11/11/2015
74 357636 UTSW Pck2 0.190 R4751 G1 225 Y 14 55542561 I54N T A missense Het probably damaging 1.000 0.372 phenotype 11/11/2015
75 357634 UTSW Ppif 0.201 R4751 G1 225 Y 14 25699499 V173A T C missense Het probably damaging 0.999 0.420 phenotype 11/11/2015
76 357542 UTSW Ptgs2 0.594 R4751 G1 225 Y 1 150104020 L292H T A missense Het probably damaging 1.000 0.031 phenotype 11/11/2015
77 357571 UTSW Ptpru 0.000 R4751 G1 181 Y 4 131802586 S604P A G missense Het probably damaging 0.970 0.174 phenotype 11/11/2015
78 357560 UTSW Qrfpr 0.000 R4751 G1 225 Y 3 36182622 H210R T C missense Het possibly damaging 0.670 0.066 phenotype 11/11/2015
79 357605 UTSW Rasgrf1 0.000 R4751 G1 225 Y 9 89910118 T41A A G missense Het probably damaging 0.996 0.060 phenotype 11/11/2015
80 357606 UTSW Rasgrf1 0.000 R4751 G1 225 Y 9 90012866 H1113R A G missense Het probably damaging 0.997 0.208 phenotype 11/11/2015
81 357564 UTSW Rhoc 0.446 R4751 G1 225 Y 3 104792647 I80N T A missense Het probably damaging 0.999 0.028 phenotype 11/11/2015
82 357644 UTSW Riok3 0.384 R4751 G1 225 Y 18 12153983 N472S A G missense Het probably benign 0.001 0.042 phenotype 11/11/2015
83 357624 UTSW Rnf213 0.000 R4751 G1 225 Y 11 119445745 Y3314C A G missense Het probably benign 0.124 0.102 phenotype 11/11/2015
84 357600 UTSW Shank2 0.000 R4751 G1 225 Y 7 144409468 T264I C T missense Het probably damaging 0.999 0.026 phenotype 11/11/2015
85 357575 UTSW Shroom3 1.000 R4751 G1 225 Y 5 92943086 V1151F G T missense Het probably damaging 0.997 0.028 phenotype 11/11/2015
86 357627 UTSW Sipa1l1 0.000 R4751 G1 225 Y 12 82341194 I65V A G missense Het probably benign 0.000 0.110 11/11/2015
87 357650 UTSW Slc22a19 0.065 R4751 G1 225 Y 19 7691145 K291R T C missense Het possibly damaging 0.650 0.028 phenotype 11/11/2015
88 357649 UTSW Slc22a20 0.278 R4751 G1 225 Y 19 5980460 I315V T C missense Het probably benign 0.006 0.124 11/11/2015
89 357566 UTSW Slc44a1 0.000 R4751 G1 225 Y 4 53560973 D563V A T missense Het probably damaging 1.000 0.270 11/11/2015
90 357643 UTSW Smchd1 0.769 R4751 G1 225 Y 17 71391468 H1104Q A T missense Het probably benign 0.006 0.128 phenotype 11/11/2015
91 357590 UTSW Spcs2 0.850 R4751 G1 225 Y 7 99844769 A T splice site Het probably null 0.466 11/11/2015
92 357626 UTSW Sptb 0.710 R4751 G1 225 Y 12 76627110 E301G T C missense Het probably benign 0.070 0.140 phenotype 11/11/2015
93 357544 UTSW Stum 0.045 R4751 G1 218 Y 1 180442669 D86G T C missense Het probably damaging 0.995 0.110 11/11/2015
94 357653 UTSW Sufu 1.000 R4751 G1 225 Y 19 46483649 D449V A T missense Het probably benign 0.011 0.060 phenotype 11/11/2015
95 357557 UTSW Sun5 0.000 R4751 G1 225 Y 2 153866016 T C splice site Het probably null 0.622 11/11/2015
96 357613 UTSW Tbc1d15 0.457 R4751 G1 225 Y 10 115202587 I574F T A missense Het probably damaging 0.999 0.450 phenotype 11/11/2015
97 357632 UTSW Tert 0.411 R4751 G1 225 Y 13 73628063 S311N G A missense Het possibly damaging 0.890 0.060 phenotype 11/11/2015
98 357561 UTSW Tiparp 0.753 R4751 G1 225 Y 3 65552804 Y507H T C missense Het probably damaging 0.996 0.434 phenotype 11/11/2015
99 357640 UTSW Tnk2 0.373 R4751 G1 225 Y 16 32679857 C158R T C missense Het probably damaging 0.996 0.052 phenotype 11/11/2015
100 357611 UTSW Tpgs1 0.248 R4751 G1 225 Y 10 79675620 S199P T C missense Het possibly damaging 0.597 0.067 phenotype 11/11/2015
[records 1 to 100 of 116] next >> last >|