Incidental Mutations

95 incidental mutations are currently displayed, and affect 92 genes.
13 are Possibly Damaging.
36 are Probably Damaging.
26 are Probably Benign.
14 are Probably Null.
6 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 95 of 95] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 357825 UTSW 1700080E11Rik 0.059 R4754 G1 179 Y 9 105144393 F151L A T missense Het probably benign 0.009 0.110 11/11/2015
2 357778 UTSW 4932438A13Rik 1.000 R4754 G1 225 Y 3 37022466 Q3663* C T nonsense Het probably null 0.604 phenotype 11/11/2015
3 357769 UTSW A130010J15Rik 0.094 R4754 G1 225 Y 1 193174529 Y63C A G missense Het probably damaging 1.000 0.406 11/11/2015
4 357785 UTSW Abcb4 0.000 R4754 G1 225 Y 5 8910717 F266L C A missense Het probably damaging 0.997 0.482 phenotype 11/11/2015
5 357814 UTSW Adam8 0.000 R4754 G1 225 Y 7 139984780 I681N A T missense Het possibly damaging 0.869 0.098 phenotype 11/11/2015
6 357788 UTSW Adgrf3 0.000 R4754 G1 225 Y 5 30197617 T A critical splice acceptor site Het probably null 0.472 11/11/2015
7 357845 UTSW Ang2 0.094 R4754 G1 225 Y 14 51195517 V136A A G missense Het probably damaging 1.000 0.284 11/11/2015
8 357766 UTSW Ankar 0.081 R4754 G1 225 Y 1 72698694 G110R C T missense Het probably damaging 1.000 0.114 11/11/2015
9 357840 UTSW Ap3b1 0.511 R4754 G1 225 Y 13 94403960 L130P T C missense Het probably damaging 1.000 0.236 phenotype 11/11/2015
10 357829 UTSW Apc2 0.267 R4754 G1 225 Y 10 80314358 W1749G T G missense Het probably benign 0.006 0.156 phenotype 11/11/2015
11 357836 UTSW Asb2 0.086 R4754 G1 225 Y 12 103323837 N565S T C missense Het possibly damaging 0.954 0.224 phenotype 11/11/2015
12 357767 UTSW B3gnt7 0.196 R4754 G1 225 Y 1 86305557 T58K C A missense Het probably benign 0.008 0.090 11/11/2015
13 357804 UTSW Brpf1 0.964 R4754 G1 225 Y 6 113320447 N876K T A missense Het possibly damaging 0.919 0.058 phenotype 11/11/2015
14 357830 UTSW Ccdc157 0.062 R4754 G1 225 Y 11 4148994 I69V T C missense Het possibly damaging 0.455 0.018 11/11/2015
15 404219 UTSW Cd109 0.000 R4754 G1 164 Y 9 78712500 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT critical splice acceptor site Het probably benign 0.156 phenotype 07/22/2016
16 357768 UTSW Cdh20 0.228 R4754 G1 129 Y 1 104984685 I555F A T missense Het probably damaging 0.993 0.350 phenotype 11/11/2015
17 357794 UTSW Cfap73 0.281 R4754 G1 225 Y 5 120629664 D274G T C missense Het probably damaging 1.000 0.178 11/11/2015
18 357783 UTSW Chd5 0.000 R4754 G1 170 Y 4 152377746 I1310N T A missense Het probably damaging 0.993 0.036 phenotype 11/11/2015
19 357816 UTSW Ckap2 0.224 R4754 G1 225 Y 8 22168895 I611F T A missense Het possibly damaging 0.931 0.064 phenotype 11/11/2015
20 357790 UTSW Cpeb2 0.338 R4754 G1 225 Y 5 43285857 I964V A G missense Het possibly damaging 0.930 0.330 phenotype 11/11/2015
21 357813 UTSW Ctbp2 1.000 R4754 G1 225 Y 7 133023558 C A splice site 5 bp Het probably null 0.643 phenotype 11/11/2015
22 404222 UTSW Dhrs2 0.000 R4754 G1 225 Y 14 55238748 I142F A T missense Het probably damaging 0.966 0.029 07/22/2016
23 357848 UTSW Dnah5 0.840 R4754 G1 225 Y 15 28420955 T A splice site Het probably null 0.603 phenotype 11/11/2015
24 357764 UTSW Dst 0.460 R4754 G1 225 Y 1 34212309 S1822P T C missense Het probably damaging 0.999 0.106 phenotype 11/11/2015
25 357777 UTSW Ect2 1.000 R4754 G1 225 Y 3 27126963 K581E T C missense Het probably damaging 0.996 0.226 phenotype 11/11/2015
26 357803 UTSW Edem1 0.206 R4754 G1 225 Y 6 108841697 T222M C T missense Het probably damaging 1.000 0.384 11/11/2015
27 357795 UTSW Eif2ak1 0.119 R4754 G1 225 Y 5 143901803 M592V A G missense Het probably damaging 0.991 0.142 phenotype 11/11/2015
28 357851 UTSW Endou 0.000 R4754 G1 225 Y 15 97726539 D49A T G missense Het probably damaging 0.993 0.025 phenotype 11/11/2015
29 357781 UTSW Ensa 0.122 R4754 G1 225 Y 3 95622554 A G unclassified Het probably benign phenotype 11/11/2015
30 357789 UTSW Evc2 1.000 R4754 G1 225 Y 5 37387031 R708L G T missense Het probably damaging 0.988 0.025 phenotype 11/11/2015
31 357857 UTSW Fam120b 0.000 R4754 G1 225 Y 17 15422962 C668S T A missense Het probably damaging 0.997 0.314 11/11/2015
32 357763 UTSW Fam135a 0.657 R4754 G1 225 Y 1 24028754 C798* A T nonsense Het probably null 0.632 11/11/2015
33 357849 UTSW Fam135b 0.000 R4754 G1 225 Y 15 71462951 D798G T C missense Het probably benign 0.011 0.032 11/11/2015
34 357842 UTSW Fam208a 1.000 R4754 G1 225 Y 14 27461095 I504L A T missense Het probably benign 0.000 0.128 phenotype 11/11/2015
35 357772 UTSW Fshb 0.143 R4754 G1 225 Y 2 107057282 *131E A C makesense Het probably null 0.450 phenotype 11/11/2015
36 357791 UTSW G3bp2 1.000 R4754 G1 225 Y 5 92054909 V441M C T missense Het possibly damaging 0.848 0.174 11/11/2015
37 357852 UTSW Galnt6 0.128 R4754 G1 225 Y 15 100699224 F354I A T missense Het probably damaging 1.000 0.386 phenotype 11/11/2015
38 357823 UTSW Gm1123 0.140 R4754 G1 225 Y 9 99023240 C A splice site 3 bp Het probably null 0.632 11/11/2015
39 357824 UTSW Gm1123 0.140 R4754 G1 225 Y 9 99023241 A T critical splice donor site 2 bp Het probably null 0.610 11/11/2015
40 357773 UTSW Gm15130 0.070 R4754 G1 225 Y 2 111142862 N115S T C missense Het unknown 0.062 11/11/2015
41 357835 UTSW Gm7104 0.465 R4754 G1 221 Y 12 88285995 A G unclassified Het noncoding transcript 0.064 11/11/2015
42 357780 UTSW Gm9762 0.151 R4754 G1 225 Y 3 78966421 A T exon Het noncoding transcript 11/11/2015
43 357801 UTSW Grip2 0.000 R4754 G1 225 Y 6 91779182 V508A A G missense Het probably damaging 0.997 0.396 phenotype 11/11/2015
44 357802 UTSW Grip2 0.000 R4754 G1 225 N 6 91779192 T505A T C missense Het probably damaging 0.974 phenotype 11/11/2015
45 404221 UTSW Haus4 0.136 R4754 G1 225 Y 14 54549892 A G critical splice donor site 2 bp Het probably null 0.502 phenotype 07/22/2016
46 357821 UTSW Herc1 0.000 R4754 G1 225 Y 9 66501206 D4571E T A missense Het probably benign 0.003 0.104 phenotype 11/11/2015
47 357838 UTSW Hnrnpk 0.809 R4754 G1 225 Y 13 58399136 T A unclassified Het probably benign phenotype 11/11/2015
48 357765 UTSW Ica1l 0.000 R4754 G1 225 Y 1 60028162 Y23C T C missense Het probably damaging 1.000 0.029 phenotype 11/11/2015
49 357807 UTSW Kansl2-ps 0.191 R4754 G1 225 Y 7 72673133 A G unclassified Het noncoding transcript 0.064 11/11/2015
50 357841 UTSW Kcnma1 0.843 R4754 G1 225 Y 14 23363836 D833G T C missense Het probably damaging 0.965 0.102 phenotype 11/11/2015
51 357787 UTSW Kmt2e 1.000 R4754 G1 225 Y 5 23482441 I430F A T missense Het possibly damaging 0.878 0.053 phenotype 11/11/2015
52 357828 UTSW Lama2 0.354 R4754 G1 225 Y 10 27118531 R1794L C A missense Het possibly damaging 0.580 0.062 phenotype 11/11/2015
53 357846 UTSW Mcpt1 0.079 R4754 G1 225 Y 14 56018680 F59I T A missense Het probably damaging 1.000 0.062 phenotype 11/11/2015
54 357784 UTSW Mib2 0.000 R4754 G1 195 Y 4 155655365 T783K G T missense Het possibly damaging 0.904 0.334 phenotype 11/11/2015
55 357826 UTSW Nlrp4g 0.076 R4754 G1 225 Y 9 124349788 T C unclassified Het noncoding transcript 0.054 11/11/2015
56 357831 UTSW Obscn 0.850 R4754 G1 225 N 11 59036043 I6352V T C missense Het possibly damaging 0.807 phenotype 11/11/2015
57 357771 UTSW Olfr1245 0.196 R4754 G1 225 Y 2 89575047 H226Q A T missense Het probably benign 0.000 0.120 phenotype 11/11/2015
58 404223 UTSW Olfr1456-ps1 0.098 R4754 G1 225 Y 19 13078861 T A exon Het noncoding transcript 0.098 07/22/2016
59 357815 UTSW Olfr531 0.062 R4754 G1 225 Y 7 140400159 A296T C T missense Het probably damaging 0.987 0.098 phenotype 11/11/2015
60 357809 UTSW Olfr68 0.060 R4754 G1 225 Y 7 103777668 I226V T C missense Het probably benign 0.001 0.168 phenotype 11/11/2015
61 357843 UTSW Olfr728 0.292 R4754 G1 225 Y 14 50140033 N202I T A missense Het possibly damaging 0.898 0.224 phenotype 11/11/2015
62 357844 UTSW Olfr728 0.292 R4754 G1 225 Y 14 50140034 N202H T G missense Het probably benign 0.020 0.198 phenotype 11/11/2015
63 357779 UTSW Pcdh10 0.342 R4754 G1 225 Y 3 45380637 R462H G A missense Het probably damaging 0.988 0.218 phenotype 11/11/2015
64 357862 UTSW Pcdhga12 0.164 R4754 G1 225 Y 18 37766551 N145K C A missense Het probably damaging 0.998 0.042 phenotype 11/11/2015
65 357833 UTSW Pik3r6 0.064 R4754 G1 209 Y 11 68544775 L613Q T A missense Het probably damaging 0.999 0.326 phenotype 11/11/2015
66 357819 UTSW Pknox2 0.246 R4754 G1 225 Y 9 36909720 D282G T C missense Het probably damaging 0.984 0.050 phenotype 11/11/2015
67 357822 UTSW Plod2 1.000 R4754 G1 225 Y 9 92606531 Y624* T G nonsense Het probably null 0.668 phenotype 11/11/2015
68 357861 UTSW Prkd3 0.266 R4754 G1 225 Y 17 78956614 V684F C A missense Het probably damaging 1.000 0.304 phenotype 11/11/2015
69 357776 UTSW Ptpn1 0.893 R4754 G1 225 Y 2 167974160 V198D T A missense Het probably damaging 1.000 0.460 phenotype 11/11/2015
70 357786 UTSW Ptpn12 1.000 R4754 G1 225 Y 5 20998589 P397Q G T missense Het probably benign 0.342 0.061 phenotype 11/11/2015
71 357847 UTSW Rad1 0.945 R4754 G1 225 Y 15 10493126 C A intron Het probably benign 0.102 phenotype 11/11/2015
72 357796 UTSW Rasl11a 0.222 R4754 G1 225 Y 5 146847015 D90G A G missense Het probably benign 0.026 0.096 phenotype 11/11/2015
73 357800 UTSW Rnf181 0.109 R4754 G1 185 Y 6 72360560 A G unclassified Het probably benign 0.068 phenotype 11/11/2015
74 357774 UTSW Ryr3 0.478 R4754 G1 225 Y 2 112757639 I2652M T C missense Het possibly damaging 0.940 0.080 phenotype 11/11/2015
75 357806 UTSW Siglecg 0.078 R4754 G1 225 Y 7 43411871 C T intron Het probably benign phenotype 11/11/2015
76 357856 UTSW Slc22a3 0.000 R4754 G1 112 Y 17 12507195 S44G T C missense Het probably benign 0.025 0.118 phenotype 11/11/2015
77 357850 UTSW Slc38a1 0.133 R4754 G1 225 Y 15 96576782 F463I A T missense Het probably damaging 0.983 0.182 phenotype 11/11/2015
78 357810 UTSW Smg1 1.000 R4754 G1 225 Y 7 118156731 A T utr 3 prime Het probably benign 0.060 phenotype 11/11/2015
79 357837 UTSW Syk 1.000 R4754 G1 225 Y 13 52612259 T C intron Het probably benign phenotype 11/11/2015
80 357860 UTSW Tbc1d5 0.000 R4754 G1 225 Y 17 50800165 I454M T C missense Het probably benign 0.031 0.072 11/11/2015
81 357818 UTSW Tmed6 0.000 R4754 G1 225 Y 8 107063730 D146Y C A missense Het probably damaging 0.988 0.128 11/11/2015
82 357834 UTSW Tmem132e 0.252 R4754 G1 225 Y 11 82444851 K828* A T nonsense Het probably null 0.706 11/11/2015
83 357853 UTSW Tmprss15 0.000 R4754 G1 225 Y 16 79054124 S294T A T missense Het probably damaging 0.980 0.198 phenotype 11/11/2015
84 357775 UTSW Trp53bp1 0.000 R4754 G1 225 Y 2 121207879 S1493P A G missense Het probably damaging 0.999 0.342 phenotype 11/11/2015
85 357782 UTSW Tshb 0.163 R4754 G1 225 Y 3 102778175 I46N A T missense Het probably damaging 0.997 0.384 phenotype 11/11/2015
86 357805 UTSW Tspan11 0.068 R4754 G1 225 Y 6 127938220 V99A T C missense Het probably benign 0.000 0.059 11/11/2015
87 357770 UTSW Ttn 1.000 R4754 G1 225 Y 2 76715561 T24176A T C missense Het probably benign 0.054 0.123 phenotype 11/11/2015
88 357799 UTSW Vmn1r8 0.071 R4754 G1 225 Y 6 57035967 M1T T C start codon destroyed Het probably null 0.999 0.616 11/11/2015
89 357858 UTSW Vmn2r104 0.115 R4754 G1 225 Y 17 20040768 Y464* A T nonsense Het probably null 0.638 11/11/2015
90 357859 UTSW Vmn2r110 0.335 R4754 G1 225 Y 17 20596196 T22A T C missense Het probably benign 0.001 0.129 11/11/2015
91 357792 UTSW Vmn2r17 0.086 R4754 G1 225 Y 5 109452849 I671K T A missense Het probably damaging 0.986 0.030 11/11/2015
92 357854 UTSW Zbtb21 0.485 R4754 G1 225 Y 16 97951266 N606D T C missense Het probably damaging 1.000 0.390 11/11/2015
93 357864 UTSW Zfy2 0.058 R4754 G1 222 Y Y 2121477 S139T A T missense Het probably benign 0.016 0.130 11/11/2015
94 357832 UTSW Zkscan17 1.000 R4754 G1 225 Y 11 59503025 R156* G A nonsense Het probably null 0.636 11/11/2015
95 357811 UTSW Zp2 0.068 R4754 G1 225 Y 7 120138318 V248A A G missense Het probably benign 0.006 0.062 phenotype 11/11/2015
[records 1 to 95 of 95]