Incidental Mutations

76 incidental mutations are currently displayed, and affect 76 genes.
11 are Possibly Damaging.
32 are Probably Damaging.
25 are Probably Benign.
7 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 368004 UTSW 1110002E22Rik 0.194 R4777 G1 225 N 3 138065742 S231R A C missense Het probably benign 0.090 12/29/2015
2 368053 UTSW 2010109I03Rik 0.035 R4777 G1 225 N 15 74880683 N48S T C missense Het probably benign 0.000 12/29/2015
3 472975 UTSW 5730455P16Rik 0.654 R4777 G1 225 N 11 80374215 I137N A T missense Het probably damaging 0.997 04/14/2017
4 368059 UTSW Abhd10 0.073 R4777 G1 225 N 16 45736916 Q176* G A nonsense Het probably null phenotype 12/29/2015
5 368021 UTSW Acer3 0.107 R4777 G1 225 N 7 98261597 Y86C T C missense Het probably damaging 1.000 12/29/2015
6 368039 UTSW Ankrd36 0.025 R4777 G1 225 N 11 5607120 V356A T C missense Het probably benign 0.000 12/29/2015
7 368002 UTSW Atp1a1 1.000 R4777 G1 225 N 3 101594996 A G critical splice donor site 2 bp Het probably null phenotype 12/29/2015
8 368007 UTSW Bmp8b 0.434 R4777 G1 225 N 4 123122000 R260Q G A missense Het possibly damaging 0.613 phenotype 12/29/2015
9 368022 UTSW C2cd3 1.000 R4777 G1 225 N 7 100416332 V775D T A missense Het possibly damaging 0.463 phenotype 12/29/2015
10 367989 UTSW Cacna1b 0.000 R4777 G1 225 N 2 24732325 I216F T A missense Het probably damaging 1.000 phenotype 12/29/2015
11 368020 UTSW Capn5 0.119 R4777 G1 218 N 7 98131718 N284I T A missense Het probably damaging 1.000 phenotype 12/29/2015
12 368060 UTSW Cbr1 0.213 R4777 G1 225 N 16 93610054 D219E C A missense Het probably benign 0.047 phenotype 12/29/2015
13 472973 UTSW Ccdc109b R4777 G1 134 N 3 129969951 Q42L T A missense Het probably damaging 0.966 04/14/2017
14 368052 UTSW Cdca2 0.088 R4777 G1 225 N 14 67713140 R114Q C T missense Het probably damaging 0.993 phenotype 12/29/2015
15 367983 UTSW Cdh7 0.180 R4777 G1 225 N 1 109994325 W49* G A nonsense Het probably null phenotype 12/29/2015
16 367997 UTSW Cep152 1.000 R4777 G1 225 N 2 125564095 V1506I C T missense Het probably benign 0.294 phenotype 12/29/2015
17 368026 UTSW Cfap97 0.089 R4777 G1 225 N 8 46195297 Q537* C T nonsense Het probably null 12/29/2015
18 368047 UTSW Cpsf2 0.983 R4777 G1 225 N 12 101996832 V385E T A missense Het probably damaging 0.993 12/29/2015
19 368036 UTSW Dse 0.476 R4777 G1 225 N 10 34153588 V502A A G missense Het possibly damaging 0.563 phenotype 12/29/2015
20 367988 UTSW Fam171a1 0.104 R4777 G1 225 N 2 3223513 F300L T A missense Het probably benign 0.029 12/29/2015
21 368040 UTSW Fnip1 0.680 R4777 G1 225 N 11 54500556 N438K T G missense Het probably damaging 1.000 phenotype 12/29/2015
22 368000 UTSW Fstl5 0.093 R4777 G1 225 N 3 76593500 T412M C T missense Het probably damaging 1.000 12/29/2015
23 368043 UTSW Gm11938 0.274 R4777 G1 225 N 11 99603233 Q12L T A missense Het unknown 12/29/2015
24 368058 UTSW Hcls1 0.410 R4777 G1 225 N 16 36955316 A171S G T missense Het probably damaging 0.999 phenotype 12/29/2015
25 368050 UTSW Hcn1 0.092 R4777 G1 124 N 13 117975733 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC small deletion Het probably benign phenotype 12/29/2015
26 368031 UTSW Hydin 0.905 R4777 G1 225 N 8 110410464 C633F G T missense Het probably damaging 0.979 phenotype 12/29/2015
27 368010 UTSW Ica1 0.209 R4777 G1 225 N 6 8644145 D381E A T missense Het probably benign 0.000 phenotype 12/29/2015
28 368006 UTSW Ift74 0.514 R4777 G1 225 N 4 94652997 K220E A G missense Het probably benign 0.003 phenotype 12/29/2015
29 367984 UTSW Igfn1 0.221 R4777 G1 207 N 1 135954862 D2748E A T missense Het probably benign 0.000 12/29/2015
30 368019 UTSW Il16 0.267 R4777 G1 225 N 7 83650896 D396E A C missense Het probably benign 0.137 phenotype 12/29/2015
31 368011 UTSW Impdh1 0.307 R4777 G1 219 N 6 29205202 A200E G T missense Het possibly damaging 0.954 phenotype 12/29/2015
32 367992 UTSW Itga4 1.000 R4777 G1 225 N 2 79313710 T647I C T missense Het possibly damaging 0.867 phenotype 12/29/2015
33 368044 UTSW Jpt1 R4777 G1 225 N 11 115500671 M104K A T missense Het probably benign 0.000 12/29/2015
34 368057 UTSW Krt73 0.359 R4777 G1 225 N 15 101794001 A476S C A missense Het probably benign 0.000 phenotype 12/29/2015
35 368062 UTSW Lama3 1.000 R4777 G1 225 N 18 12413771 Y363H T C missense Het probably damaging 0.999 phenotype 12/29/2015
36 367995 UTSW Lgr4 1.000 R4777 G1 225 N 2 109996682 P177L C T missense Het probably damaging 0.981 phenotype 12/29/2015
37 367991 UTSW Lrp2 1.000 R4777 G1 225 N 2 69482264 D2560G T C missense Het probably damaging 1.000 phenotype 12/29/2015
38 368008 UTSW Macf1 1.000 R4777 G1 156 N 4 123376502 F6617I A T missense Het probably damaging 1.000 phenotype 12/29/2015
39 368023 UTSW Mcf2l 0.302 R4777 G1 186 N 8 13018051 T A splice site Het probably null phenotype 12/29/2015
40 367980 UTSW Mfsd9 0.069 R4777 G1 225 N 1 40781540 V150I C T missense Het possibly damaging 0.636 12/29/2015
41 472976 UTSW Myo15b 0.052 R4777 G1 190 N 11 115879652 V96A T C missense Het probably damaging 0.993 04/14/2017
42 368066 UTSW Nfkb2 0.693 R4777 G1 225 N 19 46307567 E170D G T missense Het probably benign 0.017 0.090 phenotype 12/29/2015
43 368042 UTSW Olfr398 0.191 R4777 G1 225 N 11 73984395 V71A A G missense Het probably benign 0.011 phenotype 12/29/2015
44 367986 UTSW Olfr432 0.105 R4777 G1 225 N 1 174050678 Y102D T G missense Het probably damaging 0.999 phenotype 12/29/2015
45 368033 UTSW Olfr981 0.204 R4777 G1 225 N 9 40022698 F102L T C missense Het possibly damaging 0.901 phenotype 12/29/2015
46 368016 UTSW Pinlyp 0.126 R4777 G1 225 N 7 24542143 I153F T A missense Het possibly damaging 0.573 12/29/2015
47 368049 UTSW Plk2 1.000 R4777 G1 225 N 13 110397773 M296L A C missense Het probably benign 0.000 phenotype 12/29/2015
48 368027 UTSW Plvap 0.053 R4777 G1 179 N 8 71507986 Y262C T C missense Het probably benign 0.193 phenotype 12/29/2015
49 368017 UTSW Ppfia3 0.201 R4777 G1 225 N 7 45341157 G1066V C A missense Het probably damaging 1.000 phenotype 12/29/2015
50 368013 UTSW Prokr1 0.000 R4777 G1 225 N 6 87588860 M1T A G start codon destroyed Het probably null 0.975 phenotype 12/29/2015
51 367985 UTSW Ptgs2 0.432 R4777 G1 225 N 1 150105387 A474S G T missense Het probably benign 0.031 phenotype 12/29/2015
52 367982 UTSW Pth2r 0.079 R4777 G1 167 N 1 65388517 T450A A G missense Het possibly damaging 0.899 phenotype 12/29/2015
53 368065 UTSW Ranbp6 0.222 R4777 G1 225 N 19 29811637 F438L A T missense Het probably damaging 0.996 12/29/2015
54 368030 UTSW Ripor1 0.779 R4777 G1 225 N 8 105614990 Q102L A T missense Het probably damaging 1.000 12/29/2015
55 368001 UTSW Rprd2 0.516 R4777 G1 225 N 3 95787374 V116I C T missense Het probably benign 0.411 12/29/2015
56 368051 UTSW Sacs 0.376 R4777 G1 225 N 14 61211809 V3768A T C missense Het probably damaging 0.999 phenotype 12/29/2015
57 368056 UTSW Scn8a 0.811 R4777 G1 225 N 15 101015951 Y1075H T C missense Het probably damaging 0.999 phenotype 12/29/2015
58 368041 UTSW Senp3 0.633 R4777 G1 225 N 11 69678237 G366D C T missense Het probably damaging 1.000 phenotype 12/29/2015
59 368009 UTSW Smim1 R4777 G1 225 N 4 154023650 T C intron Het probably benign phenotype 12/29/2015
60 367990 UTSW Sptan1 1.000 R4777 G1 225 N 2 29996435 I817V A G missense Het probably damaging 0.977 phenotype 12/29/2015
61 472974 UTSW Stag3 0.000 R4777 G1 225 N 5 138309199 A T unclassified Het probably benign phenotype 04/14/2017
62 367981 UTSW Stk17b 0.081 R4777 G1 225 N 1 53771708 H79Q A T missense Het probably damaging 1.000 phenotype 12/29/2015
63 472978 UTSW Svil 0.375 R4777 G1 225 N 18 5088813 K1296E A G missense Het probably damaging 0.993 phenotype 04/14/2017
64 368055 UTSW Tmem117 0.370 R4777 G1 225 N 15 95094450 Y330* T A nonsense Het probably null 12/29/2015
65 472977 UTSW Tmem8 0.079 R4777 G1 201 N 17 26121541 V633A T C missense Het probably damaging 0.999 04/14/2017
66 368061 UTSW Tnxb 0.000 R4777 G1 139 N 17 34671943 R420L G T missense Het probably damaging 0.998 phenotype 12/29/2015
67 368045 UTSW Trim9 0.190 R4777 G1 190 N 12 70347071 C33F C A missense Het probably damaging 1.000 phenotype 12/29/2015
68 368014 UTSW Usp29 0.048 R4777 G1 225 N 7 6962748 Y530S A C missense Het probably benign 0.066 12/29/2015
69 368032 UTSW Vps26b 0.000 R4777 G1 224 N 9 27010456 T258A T C missense Het possibly damaging 0.922 phenotype 12/29/2015
70 368046 UTSW Vrtn 0.195 R4777 G1 225 N 12 84648826 H117N C A missense Het probably damaging 0.997 12/29/2015
71 368063 UTSW Wdr33 0.956 R4777 G1 225 N 18 31881248 H388Y C T missense Het probably damaging 1.000 phenotype 12/29/2015
72 367979 UTSW Zfp451 0.293 R4777 G1 225 N 1 33782105 V222D A T missense Het possibly damaging 0.804 12/29/2015
73 368048 UTSW Zfp953 0.050 R4777 G1 225 N 13 67343129 I253T A G missense Het probably benign 0.421 12/29/2015
74 368067 UTSW Zfy2 0.078 R4777 G1 222 N Y 2116194 V282A A G missense Het probably benign 0.001 12/29/2015
75 367996 UTSW Zscan29 0.113 R4777 G1 225 N 2 121169324 V132D A T missense Het probably damaging 0.957 12/29/2015
76 368029 UTSW Zswim4 0.388 R4777 G1 104 N 8 84236957 D16E G T missense Het probably benign 0.000 12/29/2015
[records 1 to 76 of 76]