Incidental Mutations

79 incidental mutations are currently displayed, and affect 78 genes.
8 are Possibly Damaging.
33 are Probably Damaging.
26 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 79 of 79] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 373241 UTSW 5830411N06Rik 0.150 R4836 G1 225 Y 7 140299108 I1051T T C missense Het probably benign 0.000 0.086 03/01/2016
2 373259 UTSW Acox1 0.342 R4836 G1 225 Y 11 116175326 S453T A T missense Het probably benign 0.047 0.154 phenotype 03/01/2016
3 373243 UTSW AF366264 0.527 R4836 G1 225 Y 8 13838007 S28N C T missense Het probably benign 0.000 0.144 03/01/2016
4 373264 UTSW Ahnak2 0.055 R4836 G1 225 Y 12 112774116 V368D A T missense Het probably damaging 1.000 0.034 03/01/2016
5 373232 UTSW Ankrd53 0.160 R4836 G1 223 Y 6 83768152 Y448F A T missense Het probably damaging 0.996 0.062 03/01/2016
6 373257 UTSW Arhgef15 0.136 R4836 G1 97 Y 11 68949925 A T intron Het probably benign phenotype 03/01/2016
7 373263 UTSW Atg2b 0.644 R4836 G1 225 Y 12 105646814 N1166S T C missense Het probably benign 0.000 0.057 phenotype 03/01/2016
8 373279 UTSW Atl3 0.353 R4836 G1 225 Y 19 7509545 R77* C T nonsense Het probably null 0.602 phenotype 03/01/2016
9 373206 UTSW Bend6 0.119 R4836 G1 225 Y 1 33883573 T C utr 5 prime Het probably benign 03/01/2016
10 373275 UTSW Ccnt1 0.881 R4836 G1 225 Y 15 98567563 R25L C A missense Het probably damaging 0.959 0.027 phenotype 03/01/2016
11 373254 UTSW Cct4 0.976 R4836 G1 225 Y 11 23002898 T525A A G missense Het probably benign 0.198 0.094 phenotype 03/01/2016
12 373209 UTSW Cep350 0.838 R4836 G1 225 Y 1 155928833 I835V T C missense Het probably damaging 0.997 0.250 phenotype 03/01/2016
13 373231 UTSW Clcn1 0.669 R4836 G1 225 Y 6 42309964 V652L G T missense Het probably damaging 0.964 0.340 phenotype 03/01/2016
14 373226 UTSW Cntln 0.257 R4836 G1 225 Y 4 85049720 Y725* T A nonsense Het probably null 0.650 03/01/2016
15 373260 UTSW Cog5 0.784 R4836 G1 225 Y 12 31919733 F21L T C missense Het probably benign 0.071 0.154 phenotype 03/01/2016
16 373233 UTSW D6Ertd527e 0.164 R4836 G1 217 Y 6 87111424 GGCAGCAGCAGCA GGCAGCAGCAGCAGCA small insertion Het probably benign 03/01/2016
17 373250 UTSW Dnm2 1.000 R4836 G1 225 Y 9 21491330 A T intron Het probably benign 0.072 phenotype 03/01/2016
18 373249 UTSW Dnmt1 1.000 R4836 G1 193 Y 9 20908558 V1430I C T missense Het probably damaging 1.000 0.041 phenotype 03/01/2016
19 430171 UTSW Dpep1 0.248 R4836 G1 225 Y 8 123200367 D285G A G missense Het probably damaging 0.997 0.472 phenotype 09/07/2016
20 373276 UTSW Eef2kmt 0.124 R4836 G1 209 Y 16 5249003 V129M C T missense Het probably damaging 0.984 0.066 03/01/2016
21 373277 UTSW Epha3 0.404 R4836 G1 225 Y 16 63583557 M726K A T missense Het probably damaging 1.000 0.280 phenotype 03/01/2016
22 373248 UTSW Fat3 0.436 R4836 G1 225 Y 9 16377723 L168P A G missense Het probably damaging 1.000 0.108 phenotype 03/01/2016
23 373245 UTSW Frem3 0.086 R4836 G1 225 Y 8 80663397 F1759Y T A missense Het probably damaging 0.994 0.268 phenotype 03/01/2016
24 373213 UTSW Fubp3 0.440 R4836 G1 225 Y 2 31608141 S56R T A missense Het possibly damaging 0.934 0.064 03/01/2016
25 373234 UTSW Gm1965 0.253 R4836 G1 225 Y 6 89145410 T C exon Het noncoding transcript 0.102 03/01/2016
26 373239 UTSW Gm5592 0.057 R4836 G1 225 Y 7 41215534 C T intron Het probably benign 03/01/2016
27 373258 UTSW Hils1 0.289 R4836 G1 225 Y 11 94968017 L46* T A nonsense Het probably null 0.607 phenotype 03/01/2016
28 373207 UTSW Irs1 0.411 R4836 G1 217 Y 1 82287732 TGGGGTGGACATCGAACTGAAGGAG TG frame shift Het probably null 0.640 phenotype 03/01/2016
29 373268 UTSW Isl1 1.000 R4836 G1 225 Y 13 116303083 M243T A G missense Het probably benign 0.057 0.212 phenotype 03/01/2016
30 373235 UTSW Itpr1 0.619 R4836 G1 225 Y 6 108389537 I142F A T missense Het probably damaging 0.989 0.318 phenotype 03/01/2016
31 373227 UTSW Jak1 1.000 R4836 G1 204 Y 4 101155066 T1069A T C missense Het probably damaging 0.970 0.316 phenotype 03/01/2016
32 373252 UTSW Jmjd1c 0.460 R4836 G1 225 Y 10 67233446 V1848A T C missense Het probably benign 0.209 0.140 phenotype 03/01/2016
33 373236 UTSW Kdm5a 1.000 R4836 G1 225 Y 6 120412402 V930A T C missense Het probably damaging 0.998 0.110 phenotype 03/01/2016
34 374517 UTSW Kdm5b 0.555 R4836 G1 225 Y 1 134593315 C A splice site Het probably null 0.604 phenotype 03/16/2016
35 374518 UTSW Lexm 0.057 R4836 G1 225 Y 4 106610527 T A critical splice acceptor site Het probably null 0.488 phenotype 03/16/2016
36 373237 UTSW Lilra5 0.025 R4836 G1 225 Y 7 4238714 F171L T C missense Het possibly damaging 0.711 0.098 phenotype 03/01/2016
37 373267 UTSW Map1b 1.000 R4836 G1 225 Y 13 99431054 S1720P A G missense Het unknown 0.146 phenotype 03/01/2016
38 373269 UTSW Mcpt1 0.095 R4836 G1 225 Y 14 56019560 Q185L A T missense Het probably damaging 1.000 0.226 phenotype 03/01/2016
39 373247 UTSW Mmp20 0.114 R4836 G1 225 Y 9 7644026 D238E T A missense Het possibly damaging 0.887 0.063 phenotype 03/01/2016
40 373274 UTSW Mov10l1 0.496 R4836 G1 225 Y 15 89020269 I784F A T missense Het possibly damaging 0.472 0.174 phenotype 03/01/2016
41 373272 UTSW Mroh2b 0.165 R4836 G1 225 Y 15 4904270 P101S C T missense Het probably damaging 1.000 0.160 03/01/2016
42 373256 UTSW Myh3 0.422 R4836 G1 214 Y 11 67096939 A1413S G T missense Het probably benign 0.006 0.136 phenotype 03/01/2016
43 373251 UTSW Nat6 0.126 R4836 G1 225 Y 9 107583539 Y211F A T missense Het probably damaging 1.000 0.276 phenotype 03/01/2016
44 373211 UTSW Npdc1 0.000 R4836 G1 225 Y 2 25408945 D284N G A missense Het probably damaging 1.000 0.166 phenotype 03/01/2016
45 373216 UTSW Olfr1009 0.055 R4836 G1 225 Y 2 85721449 I15V A G missense Het probably benign 0.000 0.112 phenotype 03/01/2016
46 373217 UTSW Olfr1054 0.119 R4836 G1 225 Y 2 86333227 M43K A T missense Het probably benign 0.122 0.123 phenotype 03/01/2016
47 373218 UTSW Olfr1056 0.083 R4836 G1 225 Y 2 86355750 L211F G A missense Het probably benign 0.394 0.046 phenotype 03/01/2016
48 373219 UTSW Olfr1196 0.058 R4836 G1 225 Y 2 88701200 I43T A G missense Het probably damaging 1.000 0.144 phenotype 03/01/2016
49 373255 UTSW Olfr330 0.093 R4836 G1 225 Y 11 58529482 M168R A C missense Het probably damaging 0.991 0.190 phenotype 03/01/2016
50 373242 UTSW Olfr533 0.050 R4836 G1 225 Y 7 140467076 R292G A G missense Het probably damaging 0.999 0.079 phenotype 03/01/2016
51 373244 UTSW Palld 1.000 R4836 G1 217 Y 8 61687381 T531S T A missense Het probably benign 0.107 0.042 phenotype 03/01/2016
52 373270 UTSW Parp4 0.370 R4836 G1 105 Y 14 56585738 E105G A G missense Het probably benign 0.001 0.136 phenotype 03/01/2016
53 373271 UTSW Phf11a 0.060 R4836 G1 225 Y 14 59287579 S59T A T missense Het probably damaging 0.991 0.154 03/01/2016
54 373208 UTSW Ppp1r12b 0.314 R4836 G1 126 Y 1 134955733 A17E G T missense Het probably benign 0.209 0.104 03/01/2016
55 430172 UTSW Rad50 1.000 R4836 G1 225 Y 11 53650653 I1252N A T missense Het probably damaging 0.998 0.028 phenotype 09/07/2016
56 374520 UTSW Ramp3 0.087 R4836 G1 198 Y 11 6674761 A G critical splice acceptor site Het probably null 0.534 phenotype 03/16/2016
57 373221 UTSW Rrbp1 0.297 R4836 G1 225 Y 2 143988417 T610I G A missense Het possibly damaging 0.755 0.048 03/01/2016
58 373214 UTSW Slc4a10 0.000 R4836 G1 225 Y 2 62268187 Y555C A G missense Het probably damaging 1.000 0.290 phenotype 03/01/2016
59 374519 UTSW Slc5a2 0.000 R4836 G1 225 Y 7 128267505 A G splice site 4 bp Het probably null 0.609 phenotype 03/16/2016
60 373262 UTSW Smoc1 1.000 R4836 G1 225 Y 12 81179548 D371E T A missense Het probably damaging 1.000 0.082 phenotype 03/01/2016
61 373228 UTSW Stmn1 0.000 R4836 G1 225 Y 4 134470184 T A splice site Het probably benign 0.054 phenotype 03/01/2016
62 373205 UTSW Sulf1 0.422 R4836 G1 225 Y 1 12842686 L715F C T missense Het probably benign 0.020 0.066 phenotype 03/01/2016
63 373212 UTSW Surf1 0.318 R4836 G1 225 Y 2 26914243 T180A T C missense Het possibly damaging 0.810 0.142 phenotype 03/01/2016
64 373261 UTSW Syne2 0.317 R4836 G1 224 Y 12 75979819 I3474V A G missense Het probably damaging 0.998 0.236 phenotype 03/01/2016
65 373222 UTSW Tchh 0.178 R4836 G1 195 Y 3 93445148 R632W A T missense Het unknown 0.053 03/01/2016
66 373223 UTSW Tchh 0.178 R4836 G1 225 Y 3 93447588 D1445V A T missense Het unknown 0.110 03/01/2016
67 373230 UTSW Tctn1 1.000 R4836 G1 225 Y 5 122245505 M505K A T missense Het probably benign 0.000 0.062 phenotype 03/01/2016
68 373224 UTSW Tdrkh 0.000 R4836 G1 225 Y 3 94425590 I150N T A missense Het probably damaging 1.000 0.466 phenotype 03/01/2016
69 373253 UTSW Tespa1 0.000 R4836 G1 225 Y 10 130362159 T350I C T missense Het probably benign 0.003 0.109 phenotype 03/01/2016
70 373220 UTSW Thbs1 0.473 R4836 G1 207 Y 2 118115018 Y326C A G missense Het possibly damaging 0.909 0.204 phenotype 03/01/2016
71 373246 UTSW Tmem208 0.670 R4836 G1 225 Y 8 105328664 S119F C T missense Het probably damaging 0.995 0.364 phenotype 03/01/2016
72 373273 UTSW Tmprss6 0.168 R4836 G1 89 Y 15 78445388 A91G G C missense Het probably damaging 0.997 0.012 phenotype 03/01/2016
73 373210 UTSW Trp53bp2 1.000 R4836 G1 225 Y 1 182431582 R67W C T missense Het probably damaging 1.000 0.023 phenotype 03/01/2016
74 373215 UTSW Ttn 1.000 R4836 G1 225 Y 2 76711197 I25488T A G missense Het possibly damaging 0.625 0.100 phenotype 03/01/2016
75 373278 UTSW Txnl4a 0.946 R4836 G1 225 Y 18 80222253 E111G A G missense Het probably damaging 1.000 0.522 phenotype 03/01/2016
76 373225 UTSW Unc13b 0.287 R4836 G1 225 Y 4 43237137 I3402M T G missense Het probably damaging 0.997 0.026 phenotype 03/01/2016
77 373265 UTSW Vmn1r188 0.086 R4836 G1 225 Y 13 22088121 I82L A C missense Het probably benign 0.173 0.073 03/01/2016
78 373266 UTSW Zfp65 0.199 R4836 G1 225 Y 13 67708875 V95A A G missense Het probably benign 0.146 0.098 03/01/2016
79 373229 UTSW Zfp985 0.221 R4836 G1 144 Y 4 147584155 S493R T A missense Het probably damaging 0.972 0.078 03/01/2016
[records 1 to 79 of 79]