Incidental Mutations

82 incidental mutations are currently displayed, and affect 82 genes.
11 are Possibly Damaging.
28 are Probably Damaging.
32 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 82 of 82] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 376713 UTSW Ak1 0.193 R4875 G1 225 Y 2 32631177 E119D A T missense Het probably benign 0.283 0.108 phenotype 03/17/2016
2 376723 UTSW Alox5 0.215 R4875 G1 225 Y 6 116413850 A T unclassified 4312 bp Het probably null 0.110 phenotype 03/17/2016
3 376737 UTSW Atad5 1.000 R4875 G1 225 Y 11 80120689 V1294A T C missense Het probably damaging 0.998 0.210 phenotype 03/17/2016
4 376735 UTSW BB019430 0.152 R4875 G1 225 Y 10 58704043 A G exon Het noncoding transcript 0.100 03/17/2016
5 376734 UTSW Bbs9 0.586 R4875 G1 225 Y 9 22578715 F261L T C missense Het probably benign 0.061 0.030 phenotype 03/17/2016
6 434639 UTSW Catsperb 0.110 R4875 G1 225 Y 12 101587985 N646I A T missense Het possibly damaging 0.903 0.068 10/18/2016
7 376751 UTSW Ccdc112 0.179 R4875 G1 225 Y 18 46296289 I114T A G missense Het probably damaging 0.997 0.060 03/17/2016
8 376724 UTSW Cecr2 0.556 R4875 G1 225 Y 6 120750916 L340P T C missense Het probably damaging 0.988 0.028 phenotype 03/17/2016
9 376733 UTSW Ces2e 0.037 R4875 G1 225 Y 8 104927185 V85E T A missense Het probably damaging 1.000 0.270 03/17/2016
10 472550 UTSW Cnpy2 0.113 R4875 G1 225 N 10 128326095 T79K C A missense Het probably damaging 0.961 0.158 04/14/2017
11 376722 UTSW Cntn4 0.551 R4875 G1 225 Y 6 106437913 R135H G A missense Het possibly damaging 0.613 0.102 phenotype 03/17/2016
12 376745 UTSW Cpne8 0.128 R4875 G1 225 Y 15 90648568 T A splice site Het probably benign phenotype 03/17/2016
13 376716 UTSW Ctso 0.220 R4875 G1 225 Y 3 81942381 C T intron Het probably benign 0.080 phenotype 03/17/2016
14 376720 UTSW Cyp3a16 0.497 R4875 G1 225 Y 5 145452849 M235I C A missense Het probably benign 0.006 0.125 03/17/2016
15 376728 UTSW Dll3 0.892 R4875 G1 225 Y 7 28296435 C314R A G missense Het probably damaging 1.000 0.790 phenotype 03/17/2016
16 434636 UTSW Dnah7c 0.416 R4875 G1 225 Y 1 46688925 N2928D A G missense Het probably benign 0.000 0.076 10/18/2016
17 376755 UTSW Dnase1l1 0.008 R4875 G1 222 Y X 74277038 C T critical splice donor site 1 bp Het probably null 0.488 phenotype 03/17/2016
18 376721 UTSW Dqx1 0.061 R4875 G1 225 Y 6 83061012 D460E C A missense Het probably benign 0.255 0.110 03/17/2016
19 472556 UTSW Dync1h1 1.000 R4875 G1 225 N 12 110658126 T3700N C A missense Het probably damaging 1.000 0.070 phenotype 04/14/2017
20 472552 UTSW Ehbp1 0.702 R4875 G1 225 N 11 22101164 C438R A G missense Het probably damaging 1.000 0.468 phenotype 04/14/2017
21 376750 UTSW Ehd3 0.000 R4875 G1 225 Y 17 73805304 V21G T G missense Het probably damaging 1.000 0.354 phenotype 03/17/2016
22 376741 UTSW Ero1lb 0.120 R4875 G1 225 Y 13 12604436 V440I G A missense Het probably damaging 0.986 0.330 phenotype 03/17/2016
23 472536 UTSW Fpgt 0.402 R4875 G1 225 N 3 155087913 A159V G A missense Het probably damaging 0.999 0.192 phenotype 04/14/2017
24 472539 UTSW Gcn1l1 0.944 R4875 G1 225 N 5 115576170 L123P T C missense Het possibly damaging 0.921 0.320 04/14/2017
25 472535 UTSW Gm14496 0.079 R4875 G1 225 N 2 181997433 R439W A T missense Het probably damaging 0.990 0.037 04/14/2017
26 472558 UTSW Gm20767 0.146 R4875 G1 225 N 13 120154670 V15A T C missense Het probably damaging 0.983 04/14/2017
27 376730 UTSW Gm4353 0.159 R4875 G1 225 Y 7 116084413 P49R G C missense Het probably damaging 0.994 0.023 03/17/2016
28 376744 UTSW Gsdmc2 0.096 R4875 G1 225 Y 15 63828252 A224T C T missense Het probably benign 0.405 0.123 03/17/2016
29 376740 UTSW Helz 0.000 R4875 G1 225 Y 11 107637734 T A intron Het probably benign phenotype 03/17/2016
30 376718 UTSW Hnf1a 0.491 R4875 G1 225 N 5 114970673 T58A T C missense Het probably benign 0.003 phenotype 03/17/2016
31 472540 UTSW Igkv4-80 0.061 R4875 G1 225 N 6 69016665 S81A A C missense Het probably benign 0.000 04/14/2017
32 376715 UTSW Kcns1 0.050 R4875 G1 152 Y 2 164168101 Y246C T C missense Het probably damaging 1.000 0.160 phenotype 03/17/2016
33 376709 UTSW Kif26b 1.000 R4875 G1 225 Y 1 178915327 E549G A G missense Het probably benign 0.385 0.036 phenotype 03/17/2016
34 376738 UTSW Krt9 0.000 R4875 G1 225 Y 11 100190037 I330V T C missense Het probably benign 0.060 0.052 phenotype 03/17/2016
35 434637 UTSW Lair1 0.000 R4875 G1 225 Y 7 4029034 S25T A T missense Het probably benign 0.053 0.140 phenotype 10/18/2016
36 472526 UTSW Lhx4 1.000 R4875 G1 179 N 1 155705267 T171A T C missense Het possibly damaging 0.905 0.174 phenotype 04/14/2017
37 472542 UTSW Luzp2 0.000 R4875 G1 225 N 7 55167248 I149V A G missense Het possibly damaging 0.690 0.018 phenotype 04/14/2017
38 376732 UTSW Mcoln1 0.344 R4875 G1 225 Y 8 3507422 S143T T A missense Het probably benign 0.004 0.114 phenotype 03/17/2016
39 434638 UTSW Mcph1 0.000 R4875 G1 225 Y 8 18625558 A G critical splice acceptor site Het probably null 0.468 phenotype 10/18/2016
40 376707 UTSW Mgat5 0.000 R4875 G1 225 Y 1 127469249 V578M G A missense Het probably damaging 1.000 0.073 phenotype 03/17/2016
41 472555 UTSW Mis18bp1 0.932 R4875 G1 225 N 12 65161435 T168M G A missense Het probably benign 0.230 0.130 04/14/2017
42 376752 UTSW Mospd4 0.104 R4875 G1 220 Y 18 46465737 G T exon Het noncoding transcript 03/17/2016
43 376706 UTSW Mroh2a 0.924 R4875 G1 82 N 1 88254935 R1195L G T missense Het possibly damaging 0.721 phenotype 03/17/2016
44 472560 UTSW Myom1 0.197 R4875 G1 225 N 17 71072119 V626A T C missense Het probably damaging 1.000 0.286 phenotype 04/14/2017
45 472548 UTSW Nat6 0.130 R4875 G1 225 N 9 107583619 R238C C T missense Het probably damaging 0.972 0.036 phenotype 04/14/2017
46 472546 UTSW Ncam1 0.868 R4875 G1 225 N 9 49507621 T C intron Het probably benign 0.083 phenotype 04/14/2017
47 472554 UTSW Ncor1 1.000 R4875 G1 104 N 11 62433611 AGCTGCTGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTGCTGCTG small deletion Het probably benign phenotype 04/14/2017
48 376753 UTSW Ndufv1 0.908 R4875 G1 208 Y 19 4012653 T C splice site 4 bp Het probably null 0.632 phenotype 03/17/2016
49 472541 UTSW Nlrp2 0.149 R4875 G1 225 N 7 5298859 F211L A T missense Het probably benign 0.089 0.131 phenotype 04/14/2017
50 376742 UTSW Olfr1368 0.091 R4875 G1 225 Y 13 21142280 Y259F T A missense Het probably damaging 0.999 0.130 phenotype 03/17/2016
51 376754 UTSW Olfr1495 0.099 R4875 G1 225 Y 19 13768762 M140K T A missense Het probably damaging 0.991 0.346 phenotype 03/17/2016
52 472543 UTSW Olfr517 0.154 R4875 G1 225 N 7 108868786 F123I A T missense Het probably damaging 0.994 0.140 phenotype 04/14/2017
53 376746 UTSW Osbpl11 0.353 R4875 G1 225 Y 16 33234493 V649I G A missense Het probably benign 0.001 0.068 phenotype 03/17/2016
54 376711 UTSW Pax8 1.000 R4875 G1 225 Y 2 24441640 M144L T A missense Het probably benign 0.040 0.110 phenotype 03/17/2016
55 472549 UTSW Pcnt 1.000 R4875 G1 225 N 10 76369854 T2555A T C missense Het probably benign 0.029 0.102 phenotype 04/14/2017
56 472544 UTSW Plat 0.227 R4875 G1 225 N 8 22768450 I23K T A missense Het probably benign 0.026 0.098 phenotype 04/14/2017
57 376736 UTSW Plpp2 0.000 R4875 G1 225 Y 10 79530929 T51M G A missense Het probably damaging 1.000 0.036 phenotype 03/17/2016
58 376729 UTSW Pnkp 0.957 R4875 G1 225 Y 7 44862403 S113L C T missense Het probably damaging 0.992 0.140 phenotype 03/17/2016
59 472557 UTSW Prl7c1 0.028 R4875 G1 225 N 13 27773759 M233V T C missense Het probably benign 0.006 0.161 04/14/2017
60 376710 UTSW Prox1 1.000 R4875 G1 225 Y 1 190162122 F42C A C missense Het probably damaging 0.994 0.146 phenotype 03/17/2016
61 376731 UTSW Pwwp2b 0.175 R4875 G1 225 Y 7 139256062 Q473L A T missense Het possibly damaging 0.896 0.140 03/17/2016
62 472533 UTSW Rims4 0.070 R4875 G1 225 N 2 163865523 N127K A T missense Het probably null 0.001 0.632 phenotype 04/14/2017
63 472528 UTSW Scn1a 1.000 R4875 G1 225 N 2 66328476 T367A T C missense Het possibly damaging 0.921 0.330 phenotype 04/14/2017
64 376714 UTSW Slc23a2 1.000 R4875 G1 225 Y 2 132056880 I579T A G missense Het possibly damaging 0.754 0.102 phenotype 03/17/2016
65 472529 UTSW Sp9 0.585 R4875 G1 87 N 2 73273618 V172A T C missense Het possibly damaging 0.861 0.104 04/14/2017
66 472527 UTSW Spta1 0.484 R4875 G1 225 N 1 174175830 L109Q T A missense Het probably damaging 1.000 0.298 phenotype 04/14/2017
67 376726 UTSW Strap 1.000 R4875 G1 165 Y 6 137749318 ACCTGCCCTCCT ACCT intron Het probably benign phenotype 03/17/2016
68 376747 UTSW Synj2 0.245 R4875 G1 220 Y 17 5988068 A T intron Het probably benign 0.623 phenotype 03/17/2016
69 376749 UTSW Tgif2-ps2 0.673 R4875 G1 225 Y 17 40115383 A G exon Het noncoding transcript 03/17/2016
70 376719 UTSW Tnrc18 0.422 R4875 G1 225 Y 5 142765177 M1216K A T missense Het unknown 0.068 03/17/2016
71 472538 UTSW Tpst2 0.668 R4875 G1 225 N 5 112309821 Y69* T A nonsense Het probably null 0.602 phenotype 04/14/2017
72 472531 UTSW Tpx2 1.000 R4875 G1 225 N 2 152893615 A721E C A missense Het probably benign 0.005 0.122 phenotype 04/14/2017
73 376708 UTSW Trmt1l 0.000 R4875 G1 225 Y 1 151455004 T591A A G missense Het probably benign 0.035 0.066 phenotype 03/17/2016
74 376725 UTSW Tuba8 0.506 R4875 G1 225 Y 6 121226083 T A utr 3 prime Het probably benign phenotype 03/17/2016
75 376717 UTSW Ubiad1 0.583 R4875 G1 225 Y 4 148444099 T118A T C missense Het possibly damaging 0.911 0.228 phenotype 03/17/2016
76 472547 UTSW Unc13c 0.339 R4875 G1 225 N 9 73517284 T2017A T C missense Het probably damaging 0.977 0.316 phenotype 04/14/2017
77 376727 UTSW Vmn1r59 0.065 R4875 G1 225 Y 7 5454109 N217K G T missense Het probably benign 0.000 0.124 03/17/2016
78 472551 UTSW Vmn2r87 0.117 R4875 G1 225 N 10 130472498 I624V T C missense Het probably damaging 1.000 0.084 04/14/2017
79 376748 UTSW Wdr4 0.893 R4875 G1 186 Y 17 31499155 V315A A G missense Het probably benign 0.049 0.114 phenotype 03/17/2016
80 376743 UTSW Xpo7 0.204 R4875 G1 225 Y 14 70676816 T C critical splice acceptor site Het probably null 0.592 phenotype 03/17/2016
81 472545 UTSW Zfp827 0.378 R4875 G1 225 N 8 79060774 W190R T A missense Het probably damaging 1.000 0.464 04/14/2017
82 472534 UTSW Zfp971 0.263 R4875 G1 141 N 2 178033147 T180A A G missense Het probably benign 0.237 0.154 04/14/2017
[records 1 to 82 of 82]