Incidental Mutations

76 incidental mutations are currently displayed, and affect 76 genes.
11 are Possibly Damaging.
31 are Probably Damaging.
24 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 376043 UTSW 2010005H15Rik 0.233 R4899 G1 225 N 16 36257365 Y96F A T missense Het possibly damaging 0.834 03/17/2016
2 376018 UTSW 9230110C19Rik 0.179 R4899 G1 225 N 9 8022493 S243T A T missense Het possibly damaging 0.937 03/17/2016
3 375989 UTSW Abhd18 0.103 R4899 G1 225 N 3 40905869 C G splice site Het probably null 03/17/2016
4 375999 UTSW Adra2c 0.301 R4899 G1 225 N 5 35280361 Y159F A T missense Het probably damaging 1.000 phenotype 03/17/2016
5 375995 UTSW AI481877 0.176 R4899 G1 167 N 4 59062640 Y872C T C missense Het probably damaging 0.974 03/17/2016
6 376030 UTSW Alkal2 0.045 R4899 G1 204 N 12 30884973 S64T T A missense Het probably benign 0.022 03/17/2016
7 375982 UTSW Apbb1ip 0.000 R4899 G1 225 N 2 22823349 V72A T C missense Het unknown phenotype 03/17/2016
8 376042 UTSW Atp13a5 0.195 R4899 G1 225 N 16 29378500 L13P A G missense Het probably damaging 1.000 phenotype 03/17/2016
9 375997 UTSW Azin2 0.145 R4899 G1 225 N 4 128934653 P254S G A missense Het probably benign 0.430 phenotype 03/17/2016
10 375992 UTSW Bmpr1b 0.621 R4899 G1 225 N 3 141840683 R481G T C missense Het probably damaging 1.000 phenotype 03/17/2016
11 472511 UTSW Cacna2d4 0.226 R4899 G1 225 N 6 119268196 W288* G A nonsense Het probably null phenotype 04/14/2017
12 375988 UTSW Cass4 0.089 R4899 G1 225 N 2 172427869 T626A A G missense Het probably benign 0.000 03/17/2016
13 376028 UTSW Cep112 0.329 R4899 G1 225 N 11 108606284 D683E T A missense Het probably damaging 0.964 phenotype 03/17/2016
14 376036 UTSW Chat 0.318 R4899 G1 225 N 14 32448977 S188R G T missense Het possibly damaging 0.801 phenotype 03/17/2016
15 376003 UTSW Cit 0.952 R4899 G1 225 N 5 115863028 Y162C A G missense Het possibly damaging 0.599 phenotype 03/17/2016
16 375993 UTSW Clca3a1 0.070 R4899 G1 225 N 3 144737961 Y676F T A missense Het probably damaging 0.997 03/17/2016
17 376009 UTSW Clec2h 0.047 R4899 G1 225 N 6 128675824 N185D A G missense Het probably benign 0.027 03/17/2016
18 375987 UTSW Cnbd2 0.067 R4899 G1 225 N 2 156339221 V192F G T missense Het probably benign 0.003 phenotype 03/17/2016
19 375979 UTSW Col6a3 0.000 R4899 G1 225 N 1 90802427 G1112V C A missense Het probably damaging 0.991 phenotype 03/17/2016
20 376005 UTSW Cyp3a25 0.110 R4899 G1 225 N 5 145977671 F483S A G missense Het possibly damaging 0.593 03/17/2016
21 376047 UTSW Dscam 1.000 R4899 G1 225 N 16 96683818 E1103G T C missense Het probably benign 0.008 phenotype 03/17/2016
22 376017 UTSW Dync2h1 1.000 R4899 G1 213 N 9 7131921 Q1629* G A nonsense Het probably null phenotype 03/17/2016
23 376001 UTSW E330014E10Rik R4899 G1 103 N 5 95801727 V111A T C missense Het probably benign 0.000 03/17/2016
24 376016 UTSW Enpp6 0.377 R4899 G1 225 N 8 46987083 Y38C A G missense Het probably damaging 1.000 phenotype 03/17/2016
25 376052 UTSW Epg5 0.802 R4899 G1 225 N 18 77985057 L1271Q T A missense Het probably damaging 1.000 phenotype 03/17/2016
26 376000 UTSW Fam47e 0.048 R4899 G1 174 N 5 92574669 V75I G A missense Het probably benign 0.227 03/17/2016
27 376019 UTSW Fat3 0.481 R4899 G1 225 N 9 15969799 D3259G T C missense Het probably damaging 0.998 phenotype 03/17/2016
28 376021 UTSW Fbxw28 0.054 R4899 G1 225 N 9 109330853 D211G T C missense Het probably damaging 0.993 03/17/2016
29 376006 UTSW Flnc 1.000 R4899 G1 225 N 6 29446843 N990D A G missense Het probably benign 0.167 phenotype 03/17/2016
30 376054 UTSW Frat1 R4899 G1 133 N 19 41830322 L52R T G missense Het probably damaging 1.000 phenotype 03/17/2016
31 376050 UTSW Ftmt 0.000 R4899 G1 225 N 18 52331586 C G start gained Het probably benign phenotype 03/17/2016
32 376048 UTSW H2-M1 0.116 R4899 G1 225 N 17 36671220 G163D C T missense Het probably benign 0.085 03/17/2016
33 376033 UTSW Hapln1 1.000 R4899 G1 225 N 13 89601650 K105E A G missense Het possibly damaging 0.897 phenotype 03/17/2016
34 376008 UTSW Igkv17-127 R4899 G1 225 N 6 67861397 A31S G T missense Het probably benign 0.067 03/17/2016
35 376034 UTSW Il6st 0.000 R4899 G1 225 N 13 112501161 L628P T C missense Het probably damaging 0.997 phenotype 03/17/2016
36 376046 UTSW Kcnj6 0.282 R4899 G1 225 N 16 94832613 I213T A G missense Het probably damaging 0.999 phenotype 03/17/2016
37 376029 UTSW Kidins220 1.000 R4899 G1 225 N 12 25013443 T C critical splice donor site 2 bp Het probably null phenotype 03/17/2016
38 376022 UTSW Lama2 0.537 R4899 G1 217 N 10 27043643 TTTGCGCATT TTT frame shift Het probably null 0.655 phenotype 03/17/2016
39 376026 UTSW Llgl1 1.000 R4899 G1 225 N 11 60709568 P581L C T missense Het probably benign 0.000 0.024 phenotype 03/17/2016
40 375981 UTSW Marc2 0.078 R4899 G1 219 N 1 184845624 I65N A T missense Het probably damaging 0.995 phenotype 03/17/2016
41 375985 UTSW Mertk 0.295 R4899 G1 225 N 2 128783925 P660Q C A missense Het probably damaging 1.000 phenotype 03/17/2016
42 376039 UTSW Mkl1 0.508 R4899 G1 225 N 15 81018386 Y241H A G missense Het probably damaging 1.000 phenotype 03/17/2016
43 375998 UTSW Napepld 0.000 R4899 G1 225 N 5 21683440 Y4H A G missense Het probably benign 0.001 phenotype 03/17/2016
44 376020 UTSW Ncam1 0.868 R4899 G1 225 N 9 49545251 T A critical splice acceptor site Het probably null phenotype 03/17/2016
45 375980 UTSW Nuak2 0.211 R4899 G1 225 N 1 132324986 K93* A T nonsense Het probably null phenotype 03/17/2016
46 376015 UTSW Oat 0.724 R4899 G1 225 N 7 132564222 D211E A T missense Het probably benign 0.415 phenotype 03/17/2016
47 375984 UTSW Olfr1214 0.107 R4899 G1 225 N 2 88988110 L31V A C missense Het probably null 0.125 phenotype 03/17/2016
48 376024 UTSW Olfr1355 0.133 R4899 G1 225 N 10 78879207 S12C A T missense Het probably benign 0.317 phenotype 03/17/2016
49 376040 UTSW Olfr171 0.099 R4899 G1 225 N 16 19624200 A300V G A missense Het probably benign 0.329 phenotype 03/17/2016
50 375983 UTSW Olfr348 0.035 R4899 G1 225 N 2 36786798 Q91R A G missense Het probably benign 0.037 phenotype 03/17/2016
51 376013 UTSW Olfr64 0.222 R4899 G1 225 N 7 103893465 I90T A G missense Het possibly damaging 0.539 phenotype 03/17/2016
52 375991 UTSW Pde4dip 1.000 R4899 G1 225 N 3 97709558 K1789N C A missense Het probably damaging 1.000 phenotype 03/17/2016
53 376051 UTSW Piezo2 1.000 R4899 G1 225 N 18 63078791 I1322V T C missense Het possibly damaging 0.844 phenotype 03/17/2016
54 376012 UTSW Pih1d1 0.619 R4899 G1 176 N 7 45154527 A G intron Het probably benign 03/17/2016
55 376032 UTSW Plekhd1 0.245 R4899 G1 221 N 12 80722327 S454P T C missense Het probably damaging 0.999 03/17/2016
56 376041 UTSW Polr2h 0.958 R4899 G1 225 N 16 20720553 V89M G A missense Het probably damaging 0.995 phenotype 03/17/2016
57 376004 UTSW Pptc7 0.212 R4899 G1 85 N 5 122284717 G17S G A missense Het possibly damaging 0.512 03/17/2016
58 375986 UTSW Ptpra 0.000 R4899 G1 225 N 2 130544436 V602A T C missense Het probably damaging 1.000 phenotype 03/17/2016
59 472512 UTSW Rnf123 0.296 R4899 G1 205 N 9 108063680 R654H C T missense Het probably damaging 0.997 phenotype 04/14/2017
60 375978 UTSW Rufy4 0.575 R4899 G1 225 N 1 74147663 C537R T C missense Het probably damaging 0.988 0.294 03/17/2016
61 376044 UTSW Samsn1 0.000 R4899 G1 225 N 16 75879103 S135P A G missense Het probably damaging 1.000 phenotype 03/17/2016
62 376038 UTSW Sgsm3 0.434 R4899 G1 225 N 15 81006779 N147S A G missense Het probably benign 0.129 03/17/2016
63 376053 UTSW Slc22a29 0.082 R4899 G1 225 N 19 8161569 T510A T C missense Het probably benign 0.001 03/17/2016
64 375990 UTSW Smc4 0.988 R4899 G1 225 N 3 69031811 H978Q T A missense Het probably damaging 0.970 phenotype 03/17/2016
65 376037 UTSW Sox7 1.000 R4899 G1 225 N 14 63948478 R321H G A missense Het probably damaging 1.000 phenotype 03/17/2016
66 376011 UTSW Spred3 0.303 R4899 G1 204 N 7 29161833 D307G T C missense Het probably damaging 1.000 phenotype 03/17/2016
67 376031 UTSW Syne2 0.335 R4899 G1 225 N 12 75854101 D11E T A missense Het probably benign 0.032 phenotype 03/17/2016
68 376027 UTSW Tob1 0.000 R4899 G1 107 N 11 94214452 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA small deletion Het probably benign phenotype 03/17/2016
69 376035 UTSW Top2b 0.916 R4899 G1 225 N 14 16387313 I134F A T missense Het probably damaging 1.000 phenotype 03/17/2016
70 375996 UTSW Tspan1 0.168 R4899 G1 225 N 4 116163366 R206* T A nonsense Het probably null phenotype 03/17/2016
71 376045 UTSW Ttc3 0.792 R4899 G1 225 N 16 94429455 N837I A T missense Het probably damaging 0.996 03/17/2016
72 376007 UTSW Vmn1r36 0.177 R4899 G1 166 N 6 66716565 T72A T C missense Het possibly damaging 0.929 03/17/2016
73 376002 UTSW Vmn2r10 0.178 R4899 G1 225 N 5 109003458 S97P A G missense Het probably damaging 0.996 03/17/2016
74 376025 UTSW Zfp2 0.244 R4899 G1 225 N 11 50900014 I401F T A missense Het probably damaging 1.000 03/17/2016
75 376014 UTSW Zfp629 0.354 R4899 G1 225 N 7 127611018 T540A T C missense Het possibly damaging 0.685 03/17/2016
76 472513 UTSW Zfr 1.000 R4899 G1 225 N 15 12166145 V834I G A missense Het probably benign 0.106 phenotype 04/14/2017
[records 1 to 76 of 76]