Incidental Mutations

62 incidental mutations are currently displayed, and affect 60 genes.
10 are Possibly Damaging.
25 are Probably Damaging.
19 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 378114 UTSW 1700017N19Rik 0.045 R4905 G1 225 N 10 100612818 A T unclassified 301 bp Het probably null 04/15/2016
2 378098 UTSW 1700123L14Rik 0.349 R4905 G1 225 N 6 96165930 R44S T A missense Het possibly damaging 0.773 04/15/2016
3 378121 UTSW 2700049A03Rik 1.000 R4905 G1 196 N 12 71164546 E685* G T nonsense Het probably null 0.614 phenotype 04/15/2016
4 378122 UTSW 2700049A03Rik 1.000 R4905 G1 209 N 12 71164547 E685V A T missense Het possibly damaging 0.931 0.276 phenotype 04/15/2016
5 378100 UTSW 9530053A07Rik 0.152 R4905 G1 225 N 7 28156983 K2065M A T missense Het possibly damaging 0.930 04/15/2016
6 378138 UTSW Abcc5 0.000 R4905 G1 225 N 16 20399928 S235P A G missense Het probably damaging 1.000 phenotype 04/15/2016
7 378102 UTSW Abcc6 0.803 R4905 G1 225 N 7 45995225 N842S T C missense Het probably benign 0.000 phenotype 04/15/2016
8 378080 UTSW Acbd6 0.095 R4905 G1 225 N 1 155624923 V210I G A missense Het probably benign 0.026 04/15/2016
9 378082 UTSW Ahctf1 1.000 R4905 G1 225 N 1 179748627 V2130D A T missense Het probably damaging 0.999 phenotype 04/15/2016
10 378123 UTSW Akap5 0.226 R4905 G1 183 N 12 76328433 E213G A G missense Het probably damaging 0.959 phenotype 04/15/2016
11 378118 UTSW Alyref 0.955 R4905 G1 225 N 11 120596053 T G unclassified Het probably null 04/15/2016
12 378096 UTSW Anapc5 0.950 R4905 G1 225 N 5 122817910 N152K G T missense Het probably benign 0.005 phenotype 04/15/2016
13 378085 UTSW Atp8b2 0.226 R4905 G1 225 N 3 89949008 D416E A T missense Het probably benign 0.000 phenotype 04/15/2016
14 378109 UTSW AW551984 0.160 R4905 G1 225 N 9 39597158 V354E A T missense Het probably damaging 0.994 04/15/2016
15 378143 UTSW Bag6 1.000 R4905 G1 225 N 17 35145186 E844G A G missense Het probably damaging 0.997 phenotype 04/15/2016
16 378132 UTSW Bmp1 1.000 R4905 G1 178 N 14 70491362 R590H C T missense Het probably benign 0.058 phenotype 04/15/2016
17 378126 UTSW Ccnh 0.928 R4905 G1 225 N 13 85206135 S233P T C missense Het possibly damaging 0.593 0.134 phenotype 04/15/2016
18 378083 UTSW Cdca7 0.279 R4905 G1 121 N 2 72481861 TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA TGAAGAAGAAGAAGAAGAAGAAGAAGAAGA small deletion Het probably benign phenotype 04/15/2016
19 378112 UTSW Col6a6 0.136 R4905 G1 225 N 9 105767424 S1222P A G missense Het probably damaging 0.999 04/15/2016
20 378127 UTSW Dhfr 0.780 R4905 G1 225 N 13 92365774 G118S G A missense Het probably damaging 1.000 phenotype 04/15/2016
21 500813 UTSW Dnah9 0.661 R4905 G1 225 N 11 65874124 R1414* G A nonsense Het probably null phenotype 12/01/2017
22 378088 UTSW Dnaic1 0.139 R4905 G1 225 N 4 41614269 D315G A G missense Het probably benign 0.054 phenotype 04/15/2016
23 378099 UTSW Eogt 0.141 R4905 G1 85 N 6 97142831 R139G T C missense Het probably benign 0.009 phenotype 04/15/2016
24 378081 UTSW Fh1 1.000 R4905 G1 225 N 1 175619073 G79E C T missense Het probably damaging 1.000 phenotype 04/15/2016
25 378103 UTSW Gabrg3 0.044 R4905 G1 225 N 7 56724556 Y421H A G missense Het probably damaging 0.982 phenotype 04/15/2016
26 378115 UTSW Glipr1 0.080 R4905 G1 225 N 10 111985640 R219L C A missense Het probably damaging 0.999 phenotype 04/15/2016
27 378111 UTSW Gm1123 0.119 R4905 G1 225 N 9 99009316 D360G T C missense Het probably benign 0.156 04/15/2016
28 378095 UTSW Ift81 0.888 R4905 G1 225 N 5 122591079 C T critical splice donor site 1 bp Het probably null phenotype 04/15/2016
29 378119 UTSW Itsn2 0.000 R4905 G1 146 N 12 4634583 A G unclassified Het probably benign phenotype 04/15/2016
30 378108 UTSW Kri1 0.860 R4905 G1 82 N 9 21287702 H55Q A T missense Het probably benign 0.186 phenotype 04/15/2016
31 378128 UTSW Mcidas 0.385 R4905 G1 225 N 13 112994417 A92E C A missense Het possibly damaging 0.841 phenotype 04/15/2016
32 378129 UTSW Mcidas 0.385 R4905 G1 225 N 13 112997504 T174M C T missense Het possibly damaging 0.818 phenotype 04/15/2016
33 378141 UTSW Mmp25 0.150 R4905 G1 187 N 17 23644048 G130* C A nonsense Het probably null phenotype 04/15/2016
34 500814 UTSW Myh11 1.000 R4905 G1 220 N 16 14250523 T211M G A missense Het probably benign 0.127 phenotype 12/01/2017
35 378133 UTSW Myo10 0.000 R4905 G1 225 N 15 25800212 D1458G A G missense Het probably damaging 0.989 phenotype 04/15/2016
36 378135 UTSW Ncf4 0.000 R4905 G1 223 N 15 78254904 T154A A G missense Het probably damaging 0.985 phenotype 04/15/2016
37 378130 UTSW Nfatc4 0.000 R4905 G1 225 N 14 55830582 I620T T C missense Het probably benign 0.161 phenotype 04/15/2016
38 378092 UTSW Nos3 0.683 R4905 G1 225 N 5 24367331 Y134F A T missense Het probably benign 0.011 phenotype 04/15/2016
39 378145 UTSW Olfr1459 0.155 R4905 G1 225 N 19 13146177 A161S C A missense Het probably benign 0.069 phenotype 04/15/2016
40 378089 UTSW Olfr273 0.104 R4905 G1 225 N 4 52855613 N300S T C missense Het probably damaging 0.989 phenotype 04/15/2016
41 378104 UTSW Olfr575 0.149 R4905 G1 225 N 7 102955514 I36N A T missense Het probably damaging 0.965 phenotype 04/15/2016
42 378116 UTSW Olfr799 0.090 R4905 G1 225 N 10 129647923 V265E T A missense Het possibly damaging 0.878 phenotype 04/15/2016
43 378120 UTSW Pax9 1.000 R4905 G1 225 N 12 56696626 R19S G T missense Het probably damaging 1.000 phenotype 04/15/2016
44 378144 UTSW Pcdha9 0.150 R4905 G1 225 N 18 36998892 I338T T C missense Het probably damaging 0.959 phenotype 04/15/2016
45 378137 UTSW Plxnb2 0.763 R4905 G1 225 N 15 89157411 T1730K G T missense Het probably damaging 0.999 phenotype 04/15/2016
46 378097 UTSW Rac1 1.000 R4905 G1 169 N 5 143517152 A G splice site 6 bp Het probably null phenotype 04/15/2016
47 378140 UTSW Samsn1 0.000 R4905 G1 225 N 16 75876465 F174L G T missense Het possibly damaging 0.937 phenotype 04/15/2016
48 378101 UTSW Scaf1 0.828 R4905 G1 194 N 7 45012705 T86M G A missense Het probably damaging 0.999 04/15/2016
49 378136 UTSW Smc1b 0.369 R4905 G1 225 N 15 85066227 Y1199H A G missense Het probably damaging 0.999 phenotype 04/15/2016
50 378090 UTSW Svep1 0.723 R4905 G1 225 N 4 58069308 I2826T A G missense Het probably benign 0.002 phenotype 04/15/2016
51 378105 UTSW Tex36 0.034 R4905 G1 225 N 7 133587453 V130A A G missense Het probably damaging 1.000 04/15/2016
52 378134 UTSW Tigd5 0.112 R4905 G1 97 N 15 75911403 H538R A G missense Het probably damaging 0.994 phenotype 04/15/2016
53 378106 UTSW Tlr3 0.158 R4905 G1 225 N 8 45399223 C A critical splice acceptor site Het probably null phenotype 04/15/2016
54 378125 UTSW Tubb2b 0.739 R4905 G1 225 N 13 34128204 I202N A T missense Het probably damaging 1.000 phenotype 04/15/2016
55 378110 UTSW Unc13c 0.334 R4905 G1 225 N 9 73680392 V1453A A G missense Het probably benign 0.000 phenotype 04/15/2016
56 378086 UTSW Unc5c 0.585 R4905 G1 225 N 3 141801310 T608S A T missense Het probably benign 0.189 phenotype 04/15/2016
57 378124 UTSW Vrk1 0.661 R4905 G1 225 N 12 106051828 H119N C A missense Het probably damaging 0.998 phenotype 04/15/2016
58 378139 UTSW Wdr53 0.130 R4905 G1 225 N 16 32256658 M227K T A missense Het probably benign 0.027 phenotype 04/15/2016
59 378131 UTSW Xpo4 0.431 R4905 G1 225 N 14 57638289 D129G T C missense Het possibly damaging 0.704 phenotype 04/15/2016
60 378093 UTSW Zcchc4 0.189 R4905 G1 225 N 5 52796650 I224T T C missense Het probably damaging 0.997 04/15/2016
61 378107 UTSW Zdhhc1 0.000 R4905 G1 225 N 8 105483694 E30D T A missense Het probably damaging 0.984 04/15/2016
62 378084 UTSW Zscan29 0.115 R4905 G1 225 N 2 121161383 R540T C G missense Het possibly damaging 0.533 04/15/2016
[records 1 to 62 of 62]