Incidental Mutations

99 incidental mutations are currently displayed, and affect 98 genes.
23 are Possibly Damaging.
43 are Probably Damaging.
31 are Probably Benign.
1 are Probably Null.
0 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 99 of 99] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 378563 UTSW 4930522L14Rik 0.130 R4921 G1 225 N 5 109737796 N65K A T missense Het probably benign 0.253 04/15/2016
2 378573 UTSW Abcc9 0.198 R4921 G1 225 N 6 142590436 Y1524C T C missense Het probably benign 0.000 phenotype 04/15/2016
3 378615 UTSW Acap1 0.000 R4921 G1 225 N 11 69887193 I102T A G missense Het probably damaging 0.975 04/15/2016
4 378543 UTSW Acvr2a 0.000 R4921 G1 225 N 2 48893541 V284A T C missense Het possibly damaging 0.511 phenotype 04/15/2016
5 378587 UTSW Adam3 0.000 R4921 G1 225 N 8 24684614 M712V T C missense Het probably benign 0.008 phenotype 04/15/2016
6 378622 UTSW Adck1 0.197 R4921 G1 225 N 12 88441138 V213A T C missense Het probably benign 0.101 04/15/2016
7 378559 UTSW Adgrl3 0.000 R4921 G1 225 N 5 81512110 W242L G T missense Het probably damaging 1.000 phenotype 04/15/2016
8 378648 UTSW Alk 0.170 R4921 G1 225 N 17 71904315 T857A T C missense Het probably benign 0.302 phenotype 04/15/2016
9 378570 UTSW Alms1 0.000 R4921 G1 225 N 6 85628546 T2393A A G missense Het probably benign 0.127 phenotype 04/15/2016
10 378609 UTSW Ank3 0.884 R4921 G1 225 N 10 70002109 P240L C T missense Het probably damaging 0.999 phenotype 04/15/2016
11 378549 UTSW Ankrd35 0.074 R4921 G1 146 N 3 96684824 L809M C A missense Het possibly damaging 0.609 04/15/2016
12 378649 UTSW Birc6 1.000 R4921 G1 225 N 17 74650099 L3690Q T A missense Het probably damaging 1.000 phenotype 04/15/2016
13 378561 UTSW Bmp3 0.000 R4921 G1 225 N 5 98872061 F114L C A missense Het probably damaging 1.000 phenotype 04/15/2016
14 378625 UTSW Cage1 0.124 R4921 G1 225 N 13 38019208 H627Y G A missense Het probably benign 0.332 04/15/2016
15 378585 UTSW Cars 1.000 R4921 G1 225 N 7 143569475 D468G T C missense Het probably damaging 0.999 phenotype 04/15/2016
16 378544 UTSW Ccdc148 0.171 R4921 G1 225 N 2 58829802 E487G T C missense Het probably damaging 1.000 04/15/2016
17 378639 UTSW Ccdc80 0.191 R4921 G1 225 N 16 45118167 I746F A T missense Het probably damaging 0.999 phenotype 04/15/2016
18 378586 UTSW Ccl25 0.076 R4921 G1 180 N 8 4353913 Q119R A G missense Het possibly damaging 0.920 phenotype 04/15/2016
19 378631 UTSW Cdh24 0.320 R4921 G1 225 N 14 54633215 D178N C T missense Het probably damaging 1.000 04/15/2016
20 378616 UTSW Cdk12 1.000 R4921 G1 225 N 11 98222687 T766S A T missense Het unknown phenotype 04/15/2016
21 378583 UTSW Chst15 0.143 R4921 G1 222 N 7 132247884 T443S T A missense Het probably benign 0.007 phenotype 04/15/2016
22 378572 UTSW Cnbp 1.000 R4921 G1 225 N 6 87845146 D125G T C missense Het possibly damaging 0.941 phenotype 04/15/2016
23 378539 UTSW Cntn2 0.287 R4921 G1 225 N 1 132516032 V1003E A T missense Het possibly damaging 0.485 phenotype 04/15/2016
24 378548 UTSW Crct1 0.084 R4921 G1 222 N 3 93014825 A G unclassified Het probably benign 04/15/2016
25 378593 UTSW Dand5 0.297 R4921 G1 225 N 8 84816484 C121Y C T missense Het probably damaging 1.000 phenotype 04/15/2016
26 378576 UTSW Dmkn 0.183 R4921 G1 225 N 7 30771233 D382V A T missense Het probably damaging 0.988 phenotype 04/15/2016
27 378552 UTSW Dnase2b 0.026 R4921 G1 225 N 3 146593441 T86S T A missense Het probably damaging 1.000 phenotype 04/15/2016
28 378584 UTSW Dusp8 0.176 R4921 G1 101 N 7 142082154 GCCACCACCACCACCACCACCACC GCCACCACCACCACCACCACC unclassified Het probably benign phenotype 04/15/2016
29 378632 UTSW Eef1akmt1 0.357 R4921 G1 122 N 14 57550632 V90M C T missense Het probably damaging 0.972 04/15/2016
30 378542 UTSW Egfl7 0.509 R4921 G1 225 N 2 26590980 W168L G T missense Het probably benign 0.047 phenotype 04/15/2016
31 378565 UTSW Ep400 1.000 R4921 G1 225 N 5 110665810 C2908R A G missense Het probably damaging 0.999 phenotype 04/15/2016
32 378635 UTSW Espl1 1.000 R4921 G1 225 N 15 102315241 K1076E A G missense Het probably damaging 0.980 phenotype 04/15/2016
33 378569 UTSW Exoc4 1.000 R4921 G1 225 N 6 33910517 N747D A G missense Het probably benign 0.000 phenotype 04/15/2016
34 378621 UTSW Fancm 0.846 R4921 G1 225 N 12 65077141 V191A T C missense Het probably benign 0.191 phenotype 04/15/2016
35 378574 UTSW Fbxo17 0.116 R4921 G1 196 N 7 28732789 D97G A G missense Het probably benign 0.141 phenotype 04/15/2016
36 378634 UTSW Fer1l6 0.211 R4921 G1 225 N 15 58600311 G T critical splice acceptor site Het probably null 04/15/2016
37 378613 UTSW Flt4 1.000 R4921 G1 225 N 11 49627143 W337R T C missense Het probably damaging 0.977 phenotype 04/15/2016
38 378640 UTSW Fpr-rs7 0.165 R4921 G1 225 N 17 20113820 H136R T C missense Het possibly damaging 0.701 04/15/2016
39 378592 UTSW Frem3 0.094 R4921 G1 225 N 8 80613136 I686N T A missense Het possibly damaging 0.828 phenotype 04/15/2016
40 378564 UTSW Galnt9 0.112 R4921 G1 225 N 5 110577449 K84R A G missense Het probably damaging 0.957 phenotype 04/15/2016
41 378627 UTSW Gfm2 0.617 R4921 G1 225 N 13 97175676 M760K T A missense Het probably damaging 0.986 phenotype 04/15/2016
42 378656 UTSW Glis3 0.299 R4921 G1 195 N 19 28666104 T13A T C missense Het probably damaging 0.995 phenotype 04/15/2016
43 378555 UTSW Gm13078 0.213 R4921 G1 225 N 4 143728326 K398M A T missense Het possibly damaging 0.949 04/15/2016
44 378645 UTSW H2-K1 0.115 R4921 G1 225 N 17 33997076 V323A A G missense Het possibly damaging 0.651 phenotype 04/15/2016
45 378582 UTSW Hbb-bs 0.357 R4921 G1 88 N 7 103826720 A130V G A missense Het probably damaging 0.980 phenotype 04/15/2016
46 378579 UTSW Herc2 0.870 R4921 G1 225 N 7 56229690 H4685Q T A missense Het probably benign 0.037 phenotype 04/15/2016
47 378623 UTSW Ighv5-9-1 0.157 R4921 G1 225 N 12 113736294 R56H C T missense Het possibly damaging 0.606 04/15/2016
48 378618 UTSW Itgb4 1.000 R4921 G1 225 N 11 116006605 N1548S A G missense Het probably benign 0.115 phenotype 04/15/2016
49 378642 UTSW Itpr3 0.000 R4921 G1 225 N 17 27098005 Y745H T C missense Het probably damaging 0.999 phenotype 04/15/2016
50 378644 UTSW Kank3 0.139 R4921 G1 225 N 17 33817200 G14V G T missense Het probably damaging 1.000 04/15/2016
51 378553 UTSW Kif24 0.289 R4921 G1 225 N 4 41394329 S982Y G T missense Het probably damaging 0.985 phenotype 04/15/2016
52 378641 UTSW Kifc5b 0.516 R4921 G1 225 N 17 26921023 R53W C T missense Het probably damaging 0.999 04/15/2016
53 378617 UTSW Krt39 0.334 R4921 G1 225 N 11 99514749 S442P A G missense Het possibly damaging 0.799 phenotype 04/15/2016
54 378595 UTSW Lcat 0.225 R4921 G1 225 N 8 105942442 P67L G A missense Het possibly damaging 0.921 phenotype 04/15/2016
55 378600 UTSW Maml2 0.187 R4921 G1 225 N 9 13621175 S562P T C missense Het probably damaging 0.999 04/15/2016
56 378650 UTSW Map3k8 0.000 R4921 G1 225 N 18 4349124 R65W G A missense Het possibly damaging 0.919 phenotype 04/15/2016
57 378610 UTSW Mbd3 1.000 R4921 G1 225 N 10 80395576 R12S G T missense Het probably damaging 1.000 phenotype 04/15/2016
58 378588 UTSW Msr1 0.065 R4921 G1 225 N 8 39624251 E106G T C missense Het possibly damaging 0.719 phenotype 04/15/2016
59 378614 UTSW Myh4 0.394 R4921 G1 225 N 11 67254028 L1256Q T A missense Het probably damaging 0.998 phenotype 04/15/2016
60 378608 UTSW Mypn 0.268 R4921 G1 225 N 10 63147936 T511M G A missense Het possibly damaging 0.747 phenotype 04/15/2016
61 378556 UTSW Nub1 0.796 R4921 G1 225 N 5 24701469 N331I A T missense Het probably benign 0.382 phenotype 04/15/2016
62 378611 UTSW Nup107 0.949 R4921 G1 225 N 10 117770511 V440A A G missense Het possibly damaging 0.953 phenotype 04/15/2016
63 378626 UTSW Ofcc1 0.000 R4921 G1 225 N 13 40214517 F174L A G missense Het probably benign 0.099 phenotype 04/15/2016
64 378655 UTSW Olfr1497 0.202 R4921 G1 225 N 19 13795465 I49V T C missense Het probably benign 0.028 phenotype 04/15/2016
65 378581 UTSW Olfr597 0.129 R4921 G1 225 N 7 103320543 N44I A T missense Het probably damaging 1.000 phenotype 04/15/2016
66 378602 UTSW Olfr975 0.075 R4921 G1 225 N 9 39950225 V182G A C missense Het probably damaging 0.984 phenotype 04/15/2016
67 378629 UTSW Parp2 0.754 R4921 G1 225 N 14 50819268 L310I C A missense Het probably damaging 0.987 phenotype 04/15/2016
68 378633 UTSW Pcdh20 0.348 R4921 G1 225 N 14 88469726 V46A A G missense Het probably benign 0.015 phenotype 04/15/2016
69 378652 UTSW Pcdhgb6 0.218 R4921 G1 225 N 18 37743472 D411G A G missense Het probably damaging 0.999 phenotype 04/15/2016
70 378598 UTSW Pkd1l2 0.229 R4921 G1 134 N 8 117054885 E807G T C missense Het probably benign 0.027 phenotype 04/15/2016
71 378599 UTSW Pkd1l2 0.229 R4921 G1 225 N 8 117072549 N267K A T missense Het probably damaging 0.966 phenotype 04/15/2016
72 378557 UTSW Rell1 0.061 R4921 G1 225 N 5 63936033 M126I C A missense Het probably damaging 0.998 04/15/2016
73 378601 UTSW Robo4 0.334 R4921 G1 225 N 9 37402560 E36K G A missense Het probably benign 0.000 phenotype 04/15/2016
74 378594 UTSW Rpgrip1l 1.000 R4921 G1 225 N 8 91261009 S807G T C missense Het probably benign 0.049 phenotype 04/15/2016
75 378643 UTSW Rpl10a 0.953 R4921 G1 225 N 17 28330852 V169A T C missense Het probably benign 0.146 phenotype 04/15/2016
76 378637 UTSW Rubcn 0.712 R4921 G1 225 N 16 32847294 V166I C T missense Het probably damaging 1.000 phenotype 04/15/2016
77 378630 UTSW Sall2 0.000 R4921 G1 225 N 14 52315393 E113G T C missense Het possibly damaging 0.932 phenotype 04/15/2016
78 378575 UTSW Sars2 0.573 R4921 G1 100 N 7 28752438 S423P T C missense Het possibly damaging 0.812 phenotype 04/15/2016
79 378603 UTSW Scaper 0.512 R4921 G1 225 N 9 55892235 I182T A G missense Het probably benign 0.022 04/15/2016
80 378540 UTSW Selp 0.219 R4921 G1 225 N 1 164141397 D522G A G missense Het possibly damaging 0.933 phenotype 04/15/2016
81 378580 UTSW Sema4b 0.750 R4921 G1 81 N 7 80198756 I35N T A missense Het possibly damaging 0.769 phenotype 04/15/2016
82 378567 UTSW Sgce 0.177 R4921 G1 225 N 6 4694153 F268I A T missense Het probably damaging 1.000 phenotype 04/15/2016
83 378653 UTSW Slc14a2 0.000 R4921 G1 225 N 18 78192188 A258E G T missense Het probably damaging 0.969 phenotype 04/15/2016
84 378546 UTSW Slc17a9 0.000 R4921 G1 225 N 2 180735949 Y213H T C missense Het probably benign 0.002 phenotype 04/15/2016
85 378647 UTSW Slc22a7 0.158 R4921 G1 105 N 17 46436933 I233L T G missense Het probably benign 0.004 phenotype 04/15/2016
86 378607 UTSW Slc35f1 0.270 R4921 G1 215 N 10 53062602 Q210R A G missense Het probably damaging 0.988 phenotype 04/15/2016
87 378577 UTSW Slc6a21 0.025 R4921 G1 225 N 7 45288310 E350G A G missense Het possibly damaging 0.532 04/15/2016
88 378554 UTSW Spata21 0.128 R4921 G1 170 N 4 141112091 D639V A T missense Het probably damaging 0.999 04/15/2016
89 378651 UTSW Svil 0.361 R4921 G1 225 N 18 5108631 D1519G A G missense Het probably damaging 0.996 phenotype 04/15/2016
90 378636 UTSW Tbccd1 0.234 R4921 G1 225 N 16 22841899 T56A T C missense Het probably benign 0.016 04/15/2016
91 378638 UTSW Tigit 0.048 R4921 G1 225 N 16 43662017 I118N A T missense Het probably damaging 0.996 phenotype 04/15/2016
92 378628 UTSW Tlr11 0.080 R4921 G1 225 N 14 50362885 Q776L A T missense Het possibly damaging 0.483 04/15/2016
93 378568 UTSW Tspan12 0.281 R4921 G1 225 N 6 21835449 I9S A C missense Het possibly damaging 0.663 phenotype 04/15/2016
94 378551 UTSW Unc5c 0.585 R4921 G1 225 N 3 141788966 Y347N T A missense Het probably damaging 1.000 phenotype 04/15/2016
95 378619 UTSW Unk 0.545 R4921 G1 225 N 11 116054945 T481A A G missense Het probably benign 0.000 04/15/2016
96 378624 UTSW Vmn1r192 0.213 R4921 G1 225 N 13 22187480 V190G A C missense Het probably damaging 0.999 04/15/2016
97 378605 UTSW Vnn3 0.061 R4921 G1 225 N 10 23864575 M259L A T missense Het probably benign 0.006 04/15/2016
98 378566 UTSW Zan 0.072 R4921 G1 225 N 5 137408370 T C unclassified Het probably benign phenotype 04/15/2016
99 378657 UTSW Zdhhc6 0.000 R4921 G1 213 N 19 55313210 H113R T C missense Het probably damaging 0.959 04/15/2016
[records 1 to 99 of 99]