Incidental Mutations

96 incidental mutations are currently displayed, and affect 95 genes.
17 are Possibly Damaging.
23 are Probably Damaging.
47 are Probably Benign.
9 are Probably Null.
2 create premature stop codons.
7 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 96 of 96] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 378756 UTSW 5330417C22Rik 0.151 R4923 G1 225 Y 3 108471968 C T critical splice donor site 1 bp Het probably null 0.674 phenotype 04/15/2016
2 378770 UTSW 5830473C10Rik 0.264 R4923 G1 225 Y 5 90561299 T23A A G missense Het probably benign 0.070 0.114 04/15/2016
3 378738 UTSW Aim2 0.030 R4923 G1 217 N 1 173459806 D124G A G missense Het probably benign 0.037 phenotype 04/15/2016
4 378809 UTSW Akr1c6 0.071 R4923 G1 203 Y 13 4454495 M293T T C missense Het probably damaging 0.998 0.232 phenotype 04/15/2016
5 378832 UTSW Ankhd1 0.414 R4923 G1 225 Y 18 36589452 T343A A G missense Het probably damaging 1.000 0.194 04/15/2016
6 378777 UTSW Ano2 0.246 R4923 G1 225 Y 6 125903055 T C utr 3 prime Het probably benign 0.057 phenotype 04/15/2016
7 378747 UTSW Arfgap2 0.731 R4923 G1 225 Y 2 91273659 G353R G A missense Het probably damaging 1.000 0.081 phenotype 04/15/2016
8 378741 UTSW Armc3 0.112 R4923 G1 152 Y 2 19292980 A G critical splice acceptor site Het probably null 0.470 phenotype 04/15/2016
9 378831 UTSW Armc4 0.589 R4923 G1 225 Y 18 7181787 D846H C G missense Het probably damaging 0.970 0.038 phenotype 04/15/2016
10 378752 UTSW Atp11b 0.283 R4923 G1 225 Y 3 35835379 T C critical splice donor site 2 bp Het probably null 0.524 phenotype 04/15/2016
11 378772 UTSW BC037034 0.293 R4923 G1 225 Y 5 138262379 A T unclassified Het probably benign 04/15/2016
12 378824 UTSW Brd4 1.000 R4923 G1 204 Y 17 32199240 M13T A G missense Het probably benign 0.375 0.078 phenotype 04/15/2016
13 378812 UTSW Btd 0.274 R4923 G1 225 Y 14 31662087 M10K T A missense Het possibly damaging 0.917 0.294 phenotype 04/15/2016
14 378776 UTSW C1s2 0.119 R4923 G1 225 Y 6 124625690 K515E T C missense Het probably benign 0.005 0.058 04/15/2016
15 378785 UTSW Cars 1.000 R4923 G1 225 Y 7 143569850 Y455N A T missense Het probably damaging 0.969 0.504 phenotype 04/15/2016
16 378786 UTSW Ccdc110 0.081 R4923 G1 225 Y 8 45943423 S784G A G missense Het probably benign 0.294 0.026 04/15/2016
17 378769 UTSW Chic2 0.129 R4923 G1 225 Y 5 75011211 A G intron Het probably benign phenotype 04/15/2016
18 378833 UTSW Chka 1.000 R4923 G1 225 Y 19 3892105 A T critical splice acceptor site Het probably null 0.576 phenotype 04/15/2016
19 378803 UTSW Chrne 0.104 R4923 G1 213 Y 11 70615275 I420T A G missense Het possibly damaging 0.617 0.060 phenotype 04/15/2016
20 378766 UTSW Clstn1 0.000 R4923 G1 143 Y 4 149645029 V747A T C missense Het probably benign 0.068 0.105 phenotype 04/15/2016
21 378743 UTSW Cobll1 0.231 R4923 G1 225 Y 2 65099258 S575P A G missense Het possibly damaging 0.871 0.008 04/15/2016
22 378794 UTSW Col6a6 0.134 R4923 G1 225 Y 9 105788948 L3Q A T missense Het probably damaging 0.999 0.114 04/15/2016
23 378811 UTSW Comtd1 0.162 R4923 G1 225 Y 14 21848745 A T unclassified Het probably benign 04/15/2016
24 378808 UTSW Cpsf2 0.978 R4923 G1 225 Y 12 101981984 V13A T C missense Het probably benign 0.000 0.070 04/15/2016
25 378755 UTSW Creb3l4 0.728 R4923 G1 225 Y 3 90242214 I115L T A missense Het probably benign 0.001 0.124 phenotype 04/15/2016
26 378763 UTSW Cyp2j12 0.128 R4923 G1 225 Y 4 96102109 A407T C T missense Het possibly damaging 0.906 0.108 04/15/2016
27 378806 UTSW D11Wsu47e 0.079 R4923 G1 225 Y 11 113688979 T400K C A missense Het probably benign 0.026 0.149 04/15/2016
28 378736 UTSW Ddr2 0.000 R4923 G1 225 Y 1 169997929 A G critical splice donor site 2 bp Het probably null 0.534 phenotype 04/15/2016
29 378761 UTSW Dennd4c 0.315 R4923 G1 225 Y 4 86807538 L743P T C missense Het probably damaging 1.000 0.224 04/15/2016
30 378826 UTSW Egfl8 0.139 R4923 G1 203 Y 17 34614197 T192A T C missense Het probably benign 0.202 0.128 phenotype 04/15/2016
31 378734 UTSW Elf3 0.718 R4923 G1 225 Y 1 135256735 A G intron Het probably benign 0.052 phenotype 04/15/2016
32 378754 UTSW Etv3 0.633 R4923 G1 225 Y 3 87535916 L269R T G missense Het possibly damaging 0.956 0.494 04/15/2016
33 378782 UTSW Fah 1.000 R4923 G1 225 Y 7 84602052 C A intron Het probably benign phenotype 04/15/2016
34 378781 UTSW Fam189a1 0.082 R4923 G1 225 Y 7 64767691 S322P A G missense Het probably benign 0.004 0.030 04/15/2016
35 378802 UTSW Fbll1 0.184 R4923 G1 225 Y 11 35797580 L285F C A missense Het probably benign 0.024 0.226 04/15/2016
36 378737 UTSW Fcrla 0.000 R4923 G1 225 Y 1 170921113 F154I A T missense Het probably damaging 1.000 0.422 phenotype 04/15/2016
37 378753 UTSW Fnip2 0.094 R4923 G1 225 Y 3 79489394 T A critical splice acceptor site Het probably null 0.458 phenotype 04/15/2016
38 378762 UTSW Focad 0.385 R4923 G1 225 Y 4 88196846 T C intron Het probably benign 0.120 04/15/2016
39 378759 UTSW Gabrr1 0.171 R4923 G1 225 Y 4 33162820 I462N T A missense Het possibly damaging 0.592 0.070 phenotype 04/15/2016
40 378798 UTSW Gnptab 0.901 R4923 G1 96 Y 10 88429623 T366A A G missense Het probably benign 0.170 0.172 phenotype 04/15/2016
41 378739 UTSW Hnrnpu 1.000 R4923 G1 225 Y 1 178331452 G A unclassified Het probably benign 0.088 phenotype 04/15/2016
42 378775 UTSW Il17ra 0.084 R4923 G1 225 Y 6 120477445 V299E T A missense Het possibly damaging 0.936 0.064 phenotype 04/15/2016
43 378791 UTSW Impg1 0.034 R4923 G1 225 Y 9 80345078 Q607* G A nonsense Het probably null 0.574 phenotype 04/15/2016
44 378792 UTSW Impg1 0.034 R4923 G1 225 Y 9 80345545 E374V T A missense Het probably damaging 0.984 0.106 phenotype 04/15/2016
45 378783 UTSW Itgax 0.084 R4923 G1 225 Y 7 128148528 L1039F C T missense Het probably benign 0.000 0.049 phenotype 04/15/2016
46 378740 UTSW Kcnk2 0.188 R4923 G1 225 Y 1 189339936 V65D A T missense Het probably damaging 1.000 0.324 phenotype 04/15/2016
47 378834 UTSW Kif20b 0.644 R4923 G1 225 Y 19 34941211 A C critical splice acceptor site Het probably null 0.476 phenotype 04/15/2016
48 378805 UTSW Krt9 0.000 R4923 G1 140 Y 11 100189077 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC small deletion Het probably benign 0.156 phenotype 04/15/2016
49 378751 UTSW Lama5 1.000 R4923 G1 225 Y 2 180184149 I2372L T G missense Het probably benign 0.176 0.119 phenotype 04/15/2016
50 378797 UTSW Lilrb4a 0.167 R4923 G1 225 Y 10 51492043 T85A A G missense Het possibly damaging 0.674 0.131 phenotype 04/15/2016
51 378822 UTSW Mapk13 0.475 R4923 G1 225 Y 17 28778223 H330N C A missense Het probably benign 0.000 0.084 phenotype 04/15/2016
52 378799 UTSW Mars 0.985 R4923 G1 225 Y 10 127296680 C A unclassified Het probably benign 0.058 phenotype 04/15/2016
53 378823 UTSW Mdga1 0.513 R4923 G1 225 Y 17 29838078 R818L C A missense Het probably damaging 0.988 0.146 phenotype 04/15/2016
54 378758 UTSW Mdn1 0.973 R4923 G1 225 Y 4 32671608 L476Q T A missense Het possibly damaging 0.890 0.166 04/15/2016
55 378760 UTSW Mup21 0.060 R4923 G1 136 Y 4 62147965 E178G T C missense Het probably benign 0.001 0.120 04/15/2016
56 378816 UTSW Myg1 0.370 R4923 G1 225 Y 15 102331853 N38S A G missense Het probably benign 0.000 0.127 phenotype 04/15/2016
57 378788 UTSW Ncam1 0.868 R4923 G1 225 Y 9 49505479 D837E A T missense Het probably benign 0.000 0.158 phenotype 04/15/2016
58 378820 UTSW Ncam2 0.000 R4923 G1 225 Y 16 81589791 P686L C T missense Het possibly damaging 0.478 0.042 phenotype 04/15/2016
59 378732 UTSW Nck2 0.000 R4923 G1 166 Y 1 43461071 T C intron Het probably benign phenotype 04/15/2016
60 378828 UTSW Nfya 1.000 R4923 G1 225 Y 17 48400535 T C utr 5 prime Het probably benign 0.085 phenotype 04/15/2016
61 378790 UTSW Npat 0.981 R4923 G1 225 Y 9 53571030 K1346R A G missense Het probably damaging 0.998 0.436 04/15/2016
62 378746 UTSW Olfr1245 0.118 R4923 G1 225 Y 2 89575679 T16A T C missense Het probably damaging 0.980 0.043 phenotype 04/15/2016
63 378784 UTSW Olfr530 0.039 R4923 G1 225 N 7 140373007 T201K G T missense Het probably benign 0.109 phenotype 04/15/2016
64 378800 UTSW Olfr805 0.093 R4923 G1 225 Y 10 129722812 V244A A G missense Het probably benign 0.026 0.063 phenotype 04/15/2016
65 378796 UTSW Pde7b 0.197 R4923 G1 225 Y 10 20413127 Q325K G T missense Het probably damaging 0.981 0.050 phenotype 04/15/2016
66 378742 UTSW Pla2r1 0.000 R4923 G1 225 Y 2 60422712 M1345K A T missense Het probably benign 0.310 0.128 phenotype 04/15/2016
67 378767 UTSW Prkcz 0.000 R4923 G1 225 Y 4 155357489 D62G T C missense Het probably damaging 1.000 0.414 phenotype 04/15/2016
68 378819 UTSW Pros1 1.000 R4923 G1 225 Y 16 62903572 C228S T A missense Het possibly damaging 0.861 0.686 phenotype 04/15/2016
69 378735 UTSW Ptprc 0.349 R4923 G1 225 Y 1 138078498 M782T A G missense Het possibly damaging 0.933 0.104 phenotype 04/15/2016
70 378748 UTSW Rcn1 0.204 R4923 G1 225 Y 2 105389173 D225G T C missense Het probably benign 0.063 0.528 phenotype 04/15/2016
71 439472 UTSW Recql4 1.000 R4923 G1 27 Y 15 76710181 R46C G A missense Het probably damaging 1.000 0.302 phenotype 10/31/2016
72 378764 UTSW Rnf220 0.713 R4923 G1 225 Y 4 117489600 R205Q C T missense Het possibly damaging 0.713 0.284 04/15/2016
73 378757 UTSW Samd13 0.160 R4923 G1 225 Y 3 146662747 D11G T C missense Het probably benign 0.057 0.056 04/15/2016
74 378749 UTSW Scp2d1 0.086 R4923 G1 225 Y 2 144824110 I123K T A missense Het probably benign 0.064 0.150 04/15/2016
75 378804 UTSW Skap1 0.136 R4923 G1 225 Y 11 96754044 Y311F A T missense Het probably damaging 1.000 0.102 phenotype 04/15/2016
76 378810 UTSW Slc17a2 0.072 R4923 G1 225 Y 13 23819095 V243M G A missense Het probably benign 0.204 0.067 04/15/2016
77 378750 UTSW Slc2a10 0.149 R4923 G1 214 Y 2 165514756 I112T T C missense Het possibly damaging 0.622 0.130 phenotype 04/15/2016
78 378814 UTSW Slc39a2 0.025 R4923 G1 225 Y 14 51895254 G218D G A missense Het probably damaging 1.000 0.184 phenotype 04/15/2016
79 378830 UTSW Sos1 1.000 R4923 G1 225 Y 17 80434952 N382S T C missense Het probably benign 0.097 0.062 phenotype 04/15/2016
80 378773 UTSW Spam1 0.000 R4923 G1 225 Y 6 24796656 T202I C T missense Het probably damaging 0.999 0.528 phenotype 04/15/2016
81 378774 UTSW Tas2r138 0.041 R4923 G1 225 Y 6 40612886 Q142L T A missense Het possibly damaging 0.821 0.046 phenotype 04/15/2016
82 378768 UTSW Tec 0.182 R4923 G1 225 Y 5 72782022 R217* T A nonsense Het probably null 0.678 phenotype 04/15/2016
83 378733 UTSW Tmeff2 1.000 R4923 G1 225 Y 1 50930645 V90D T A missense Het probably benign 0.293 0.048 phenotype 04/15/2016
84 378771 UTSW Tmem119 0.000 R4923 G1 177 Y 5 113795344 Y132C T C missense Het probably damaging 1.000 0.484 phenotype 04/15/2016
85 378793 UTSW Topbp1 1.000 R4923 G1 225 Y 9 103312836 I204V A G missense Het probably benign 0.001 0.078 phenotype 04/15/2016
86 378745 UTSW Ttn 1.000 R4923 G1 225 Y 2 76770888 I17001N A T missense Het probably damaging 0.975 0.070 phenotype 04/15/2016
87 439473 UTSW Vit 0.175 R4923 G1 225 Y 17 78586841 M224K T A missense Het probably benign 0.033 0.110 phenotype 10/31/2016
88 378779 UTSW Vmn1r179 0.064 R4923 G1 225 Y 7 23929066 H227Q T G missense Het possibly damaging 0.792 0.065 04/15/2016
89 378778 UTSW Vmn1r84 0.068 R4923 G1 225 Y 7 12361816 N305D T C missense Het probably benign 0.000 0.112 04/15/2016
90 378780 UTSW Vmn2r61 0.105 R4923 G1 225 Y 7 42267096 N378D A G missense Het probably damaging 1.000 0.021 04/15/2016
91 378801 UTSW Vmn2r87 0.117 R4923 G1 225 Y 10 130478566 Y384H A G missense Het probably damaging 0.988 0.071 04/15/2016
92 378825 UTSW Wiz 1.000 R4923 G1 225 Y 17 32361596 A294T C T missense Het probably benign 0.011 0.128 phenotype 04/15/2016
93 378829 UTSW Xdh 0.605 R4923 G1 225 Y 17 73924936 V260L C A missense Het possibly damaging 0.724 0.068 phenotype 04/15/2016
94 378744 UTSW Xirp2 0.265 R4923 G1 225 Y 2 67512893 K1826R A G missense Het probably benign 0.000 0.129 phenotype 04/15/2016
95 378795 UTSW Zfp445 0.593 R4923 G1 225 Y 9 122852293 I861R A C missense Het probably benign 0.000 0.111 04/15/2016
96 378765 UTSW Zfp691 0.470 R4923 G1 93 Y 4 119170802 T78A T C missense Het probably benign 0.000 0.126 04/15/2016
[records 1 to 96 of 96]