Incidental Mutations

86 incidental mutations are currently displayed, and affect 86 genes.
17 are Possibly Damaging.
23 are Probably Damaging.
29 are Probably Benign.
15 are Probably Null.
5 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 86 of 86] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 391217 UTSW Adgrd1 0.000 R5024 G1 156 Y 5 129171895 N575S A G missense Het probably damaging 1.000 0.134 phenotype 06/06/2016
2 391255 UTSW Akap6 0.617 R5024 G1 225 Y 12 53142562 T2253M C T missense Het probably benign 0.012 0.124 phenotype 06/06/2016
3 391273 UTSW Arhgef37 0.141 R5024 G1 225 Y 18 61506440 N289K A C missense Het probably damaging 0.993 0.070 06/06/2016
4 391271 UTSW Armc4 0.249 R5024 G1 225 Y 18 7088555 M1005V T C missense Het probably benign 0.017 0.152 phenotype 06/06/2016
5 391251 UTSW Atad2b 0.000 R5024 G1 225 Y 12 4937534 T121P A C missense Het probably benign 0.450 0.119 phenotype 06/06/2016
6 391227 UTSW Atp4a 0.144 R5024 G1 225 Y 7 30715864 D303A A C missense Het possibly damaging 0.822 0.100 phenotype 06/06/2016
7 391216 UTSW BC005561 0.950 R5024 G1 225 Y 5 104522258 K1549E A G missense Het possibly damaging 0.679 0.050 06/06/2016
8 391219 UTSW Calu 0.562 R5024 G1 225 Y 6 29374519 A T utr 3 prime Het probably benign phenotype 06/06/2016
9 391198 UTSW Ccdc141 0.000 R5024 G1 225 Y 2 77054703 N531K A C missense Het probably benign 0.174 0.113 phenotype 06/06/2016
10 391214 UTSW Ccdc146 0.000 R5024 G1 225 Y 5 21399614 T C splice site 3 bp Het probably null 0.602 phenotype 06/06/2016
11 391221 UTSW Cd207 0.052 R5024 G1 225 Y 6 83674319 T218I G A missense Het probably damaging 1.000 0.132 phenotype 06/06/2016
12 391270 UTSW Cd2ap 0.000 R5024 G1 215 Y 17 42805345 A C splice site Het probably null 0.639 phenotype 06/06/2016
13 391226 UTSW Clip3 0.905 R5024 G1 224 Y 7 30292219 G A unclassified Het probably benign 0.056 phenotype 06/06/2016
14 391213 UTSW Clstn1 0.000 R5024 G1 225 Y 4 149635294 R432H G A missense Het possibly damaging 0.910 0.114 phenotype 06/06/2016
15 391211 UTSW Csmd2 0.162 R5024 G1 225 Y 4 128321348 Y521C A G missense Het possibly damaging 0.941 0.178 06/06/2016
16 391268 UTSW Dnah8 0.382 R5024 G1 225 Y 17 30736096 E2033V A T missense Het probably damaging 0.995 0.304 phenotype 06/06/2016
17 391196 UTSW Eng 1.000 R5024 G1 218 Y 2 32673392 V319G T G missense Het probably benign 0.001 0.115 phenotype 06/06/2016
18 391208 UTSW Erp44 0.914 R5024 G1 225 Y 4 48241296 W57* C T nonsense Het probably null 0.548 phenotype 06/06/2016
19 391254 UTSW Etv1 0.365 R5024 G1 225 Y 12 38854234 T A splice site 6 bp Het probably null 0.636 phenotype 06/06/2016
20 391266 UTSW Eva1c 0.083 R5024 G1 225 Y 16 90876193 T C critical splice donor site 2 bp Het probably null 0.426 phenotype 06/06/2016
21 391234 UTSW Fam196a 1.000 R5024 G1 225 Y 7 134918478 S108P A G missense Het probably damaging 1.000 0.262 phenotype 06/06/2016
22 391207 UTSW Fam221b 0.079 R5024 G1 225 Y 4 43659674 N482I T A missense Het probably damaging 0.995 0.058 06/06/2016
23 391262 UTSW Fam83h 0.316 R5024 G1 225 Y 15 76005142 H202R T C missense Het probably damaging 0.998 0.084 phenotype 06/06/2016
24 391241 UTSW Fbxw13 0.063 R5024 G1 225 Y 9 109179335 T449A T C missense Het probably benign 0.005 0.115 06/06/2016
25 391242 UTSW Fbxw25 0.077 R5024 G1 225 Y 9 109663374 A T critical splice donor site 2 bp Het probably null 0.526 06/06/2016
26 452886 UTSW Frmd3 0.304 R5024 G1 225 Y 4 74098144 S99T T A missense Het probably benign 0.003 0.126 phenotype 01/23/2017
27 391224 UTSW Gm5155 0.000 R5024 G1 225 Y 7 17910682 I575V A G missense Het probably benign 0.061 0.112 06/06/2016
28 391246 UTSW Gm5174 0.080 R5024 G1 225 Y 10 86656587 G T unclassified Het noncoding transcript 0.658 06/06/2016
29 391258 UTSW Gm6904 0.061 R5024 G1 225 Y 14 59258483 T C intron 16 bp Het probably null 0.624 06/06/2016
30 391276 UTSW Gm815 0.067 R5024 G1 225 Y 19 26887775 Q49* C T nonsense Het probably null 0.622 06/06/2016
31 391269 UTSW H2-DMa 0.270 R5024 G1 225 Y 17 34138487 I245F A T missense Het possibly damaging 0.775 0.152 phenotype 06/06/2016
32 391237 UTSW Herc1 0.000 R5024 G1 225 Y 9 66470326 K3458M A T missense Het possibly damaging 0.479 0.132 phenotype 06/06/2016
33 391232 UTSW Hirip3 0.000 R5024 G1 214 Y 7 126864489 A G splice site 4 bp Het probably null 0.630 phenotype 06/06/2016
34 452884 UTSW Hjurp 0.934 R5024 G1 69 Y 1 88275050 Y71N A T missense Het possibly damaging 0.593 0.097 01/23/2017
35 391193 UTSW Hmcn1 0.000 R5024 G1 225 Y 1 150680688 E2449V T A missense Het possibly damaging 0.655 0.068 phenotype 06/06/2016
36 391264 UTSW Igll1 0.074 R5024 G1 225 Y 16 16863793 H33N G T missense Het probably benign 0.050 0.055 phenotype 06/06/2016
37 391215 UTSW Il6 0.253 R5024 G1 225 Y 5 30019514 L184P T C missense Het probably damaging 1.000 0.216 phenotype 06/06/2016
38 391265 UTSW Impg2 0.126 R5024 G1 225 Y 16 56260100 S756T T A missense Het probably damaging 0.967 0.034 phenotype 06/06/2016
39 452887 UTSW Kank4 0.083 R5024 G1 225 Y 4 98785661 D5A T G missense Het probably damaging 0.985 0.130 01/23/2017
40 452888 UTSW Kcna7 0.125 R5024 G1 72 Y 7 45406591 R77H G A missense Het probably damaging 1.000 0.402 phenotype 01/23/2017
41 391261 UTSW Kcns2 0.000 R5024 G1 225 Y 15 34839537 T349S A T missense Het probably benign 0.264 0.030 phenotype 06/06/2016
42 391235 UTSW Keap1 0.961 R5024 G1 225 Y 9 21237226 Y162H A G missense Het probably damaging 1.000 0.256 phenotype 06/06/2016
43 391243 UTSW Kif9 0.195 R5024 G1 225 Y 9 110483093 F10L T C missense Het possibly damaging 0.809 0.172 06/06/2016
44 391238 UTSW Klhdc8b 0.168 R5024 G1 217 Y 9 108448985 ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC intron Het probably benign 0.060 phenotype 06/06/2016
45 391229 UTSW Klk14 0.000 R5024 G1 225 Y 7 43692077 C51Y G A missense Het probably damaging 1.000 0.628 phenotype 06/06/2016
46 391259 UTSW Lpar6 1.000 R5024 G1 225 Y 14 73239369 T257A A G missense Het probably damaging 0.992 0.078 phenotype 06/06/2016
47 391252 UTSW Lpin1 0.434 R5024 G1 193 Y 12 16554006 L608Q A T missense Het probably benign 0.381 0.063 phenotype 06/06/2016
48 391256 UTSW Lyst 0.478 R5024 G1 225 Y 13 13634404 S220P T C missense Het probably benign 0.000 0.056 phenotype 06/06/2016
49 391220 UTSW M1ap 0.071 R5024 G1 225 Y 6 83028358 A G unclassified Het probably benign 0.069 phenotype 06/06/2016
50 391247 UTSW Mbd6 1.000 R5024 G1 181 Y 10 127286441 V173I C T missense Het probably benign 0.160 0.140 06/06/2016
51 391274 UTSW Myo5b 0.659 R5024 G1 225 Y 18 74716034 T1115S A T missense Het possibly damaging 0.901 0.072 phenotype 06/06/2016
52 391209 UTSW Mysm1 0.233 R5024 G1 225 Y 4 94951016 V683F C A missense Het possibly damaging 0.466 0.194 phenotype 06/06/2016
53 391244 UTSW Nlrp4g 0.076 R5024 G1 225 Y 9 124350155 T A unclassified Het noncoding transcript 0.128 06/06/2016
54 391199 UTSW Olfr1040 0.175 R5024 G1 225 Y 2 86146533 A67E G T missense Het probably damaging 0.999 0.028 phenotype 06/06/2016
55 391200 UTSW Olfr1062 0.093 R5024 G1 225 Y 2 86423461 G72S C T missense Het possibly damaging 0.775 0.054 phenotype 06/06/2016
56 391231 UTSW Olfr292 0.084 R5024 G1 225 Y 7 86694881 M142L A T missense Het probably benign 0.054 0.172 phenotype 06/06/2016
57 391248 UTSW Olfr318 0.134 R5024 G1 225 Y 11 58720950 I33F T A missense Het probably benign 0.001 0.122 phenotype 06/06/2016
58 452885 UTSW Otud6b 0.510 R5024 G1 202 Y 4 14826293 Q34L T A missense Het probably damaging 1.000 0.534 phenotype 01/23/2017
59 391222 UTSW Parp11 0.000 R5024 G1 225 Y 6 127471636 T72I C T missense Het probably damaging 1.000 0.284 phenotype 06/06/2016
60 391195 UTSW Pbx1 1.000 R5024 G1 225 Y 1 168183589 D343V T A missense Het possibly damaging 0.931 0.064 phenotype 06/06/2016
61 391192 UTSW Ppp1r12b 0.286 R5024 G1 142 Y 1 134955733 A17E G T missense Het probably benign 0.209 0.104 06/06/2016
62 391212 UTSW Pramef20 0.000 R5024 G1 225 Y 4 144373308 E296* C A nonsense Het probably null 0.628 06/06/2016
63 391257 UTSW Ranbp9 0.959 R5024 G1 225 Y 13 43434855 I67N A T missense Het probably damaging 0.993 0.304 phenotype 06/06/2016
64 391225 UTSW Rasgrp4 0.000 R5024 G1 225 Y 7 29148407 E414G A G missense Het probably damaging 1.000 0.268 phenotype 06/06/2016
65 391191 UTSW Rbbp5 0.964 R5024 G1 225 Y 1 132490488 H15R A G missense Het possibly damaging 0.655 0.104 phenotype 06/06/2016
66 391277 UTSW Scd2 1.000 R5024 G1 225 Y 19 44301271 Y235C A G missense Het probably benign 0.017 0.126 phenotype 06/06/2016
67 391205 UTSW Sdr16c5 0.100 R5024 G1 225 Y 4 4010365 G170S C T missense Het probably damaging 1.000 0.028 phenotype 06/06/2016
68 391190 UTSW Sh3bp4 0.000 R5024 G1 214 Y 1 89145595 G722C G T missense Het probably damaging 1.000 0.266 phenotype 06/06/2016
69 391249 UTSW Shmt1 0.000 R5024 G1 210 Y 11 60797479 A T intron Het probably benign 0.062 phenotype 06/06/2016
70 391201 UTSW Slc12a1 0.341 R5024 G1 225 Y 2 125166137 I206V A G missense Het probably benign 0.005 0.224 phenotype 06/06/2016
71 391253 UTSW Slc26a3 0.568 R5024 G1 225 Y 12 31453908 D304G A G missense Het probably benign 0.000 0.052 phenotype 06/06/2016
72 391206 UTSW Slc26a7 0.253 R5024 G1 225 Y 4 14532572 D434V T A missense Het possibly damaging 0.907 0.206 phenotype 06/06/2016
73 391230 UTSW Slc6a16 0.080 R5024 G1 225 Y 7 45259966 M185I G T missense Het probably benign 0.023 phenotype 06/06/2016
74 391189 UTSW Stat4 0.572 R5024 G1 225 Y 1 52082570 I363V A G missense Het possibly damaging 0.803 0.090 phenotype 06/06/2016
75 391233 UTSW Tgfb1i1 0.404 R5024 G1 225 Y 7 128248217 M1I G T start codon destroyed Het probably null 0.332 0.040 phenotype 06/06/2016
76 391236 UTSW Tmem225 0.064 R5024 G1 225 Y 9 40149343 V66A T C missense Het probably benign 0.006 0.120 06/06/2016
77 391260 UTSW Tmtc4 0.000 R5024 G1 225 Y 14 122941302 T C splice site 3 bp Het probably null 0.637 06/06/2016
78 391203 UTSW Trpc4 0.133 R5024 G1 225 Y 3 54194796 N38K T A missense Het probably benign 0.114 0.028 phenotype 06/06/2016
79 391263 UTSW Ttll12 0.000 R5024 G1 120 Y 15 83587113 Y218N A T missense Het probably damaging 1.000 0.532 06/06/2016
80 391197 UTSW Ttn 1.000 R5024 G1 225 Y 2 76948425 A T splice site Het probably null 0.646 phenotype 06/06/2016
81 391267 UTSW Tulp1 0.531 R5024 G1 225 Y 17 28351995 Y178* A C nonsense Het probably null 0.616 phenotype 06/06/2016
82 391228 UTSW Vmn2r58 0.416 R5024 G1 225 Y 7 41864322 V299A A G missense Het probably damaging 0.992 0.023 06/06/2016
83 391245 UTSW Washc4 0.848 R5024 G1 225 Y 10 83583336 Q911K C A missense Het possibly damaging 0.707 0.242 phenotype 06/06/2016
84 391204 UTSW Wdr3 0.950 R5024 G1 225 Y 3 100154936 D221G T C missense Het probably benign 0.000 0.109 phenotype 06/06/2016
85 391218 UTSW Zan 0.106 R5024 G1 225 Y 5 137461893 C1245* A T nonsense Het probably null 0.712 phenotype 06/06/2016
86 391210 UTSW Zfyve9 0.782 R5024 G1 225 Y 4 108691669 S773A A C missense Het probably benign 0.177 0.034 phenotype 06/06/2016
[records 1 to 86 of 86]