Incidental Mutations

39 incidental mutations are currently displayed, and affect 39 genes.
5 are Possibly Damaging.
19 are Probably Damaging.
10 are Probably Benign.
4 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 39 of 39] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 486778 UTSW 2610021A01Rik 0.089 R5235 G1 225 N 7 41624832 H126Q C A missense Het possibly damaging 0.533 08/17/2017
2 398284 UTSW Acot11 0.252 R5235 G1 225 N 4 106760130 G240R C T missense Het probably damaging 1.000 0.600 phenotype 07/06/2016
3 398306 UTSW Aga 1.000 R5235 G1 225 N 8 53514326 H124R A G missense Het probably damaging 1.000 phenotype 07/06/2016
4 398302 UTSW Ank1 0.367 R5235 G1 225 N 8 23082196 G49R G A missense Het probably damaging 1.000 phenotype 07/06/2016
5 398261 UTSW Aox1 0.000 R5235 G1 225 N 1 58057555 V270L G T missense Het possibly damaging 0.771 phenotype 07/06/2016
6 398273 UTSW Arfrp1 1.000 R5235 G1 225 N 2 181359505 H145R T C missense Het probably benign 0.001 phenotype 07/06/2016
7 398322 UTSW Atg14 0.614 R5235 G1 225 N 14 47568199 R70C G A missense Het probably damaging 0.981 0.270 phenotype 07/06/2016
8 398330 UTSW Atg3 0.635 R5235 G1 225 N 16 45159157 T20A A G missense Het probably benign 0.150 phenotype 07/06/2016
9 398295 UTSW C3ar1 0.000 R5235 G1 225 N 6 122850922 L112P A G missense Het probably damaging 1.000 phenotype 07/06/2016
10 398293 UTSW Clip2 0.349 R5235 G1 225 N 5 134522791 T159M G A missense Het possibly damaging 0.460 phenotype 07/06/2016
11 398324 UTSW Csmd3 0.833 R5235 G1 225 N 15 47629278 T3156A T C missense Het probably benign 0.203 07/06/2016
12 398313 UTSW Dag1 0.687 R5235 G1 225 N 9 108207698 Y748C T C missense Het probably damaging 0.979 phenotype 07/06/2016
13 398320 UTSW Dek 0.000 R5235 G1 225 N 13 47086479 A T unclassified 1883 bp Het probably null phenotype 07/06/2016
14 398288 UTSW Fras1 0.000 R5235 G1 225 N 5 96600750 V695M G A missense Het probably benign 0.020 phenotype 07/06/2016
15 398279 UTSW Gm4858 0.771 R5235 G1 225 N 3 93074086 D137G A G missense Het probably damaging 1.000 07/06/2016
16 398286 UTSW Gpx7 0.107 R5235 G1 225 N 4 108400992 S135P A G missense Het probably damaging 0.997 phenotype 07/06/2016
17 398304 UTSW Ido2 0.000 R5235 G1 225 N 8 24547186 I168N A T missense Het probably damaging 0.988 phenotype 07/06/2016
18 398311 UTSW Lca5 0.284 R5235 G1 225 N 9 83423054 L233* A T nonsense Het probably null phenotype 07/06/2016
19 398328 UTSW Liph 0.000 R5235 G1 225 N 16 21984035 L95V A C missense Het probably damaging 1.000 phenotype 07/06/2016
20 398307 UTSW Mast1 0.413 R5235 G1 225 N 8 84913439 L1113Q A T missense Het probably damaging 1.000 07/06/2016
21 398310 UTSW Nlrx1 0.151 R5235 G1 225 N 9 44263750 G243D C T missense Het probably damaging 0.990 phenotype 07/06/2016
22 398267 UTSW Olfr1168 0.086 R5235 G1 225 N 2 88185568 D230E T A missense Het probably benign 0.000 phenotype 07/06/2016
23 398269 UTSW Olfr1187-ps1 0.157 R5235 G1 225 N 2 88540425 G A exon Het noncoding transcript 07/06/2016
24 398300 UTSW Otoa 0.000 R5235 G1 225 N 7 121156470 L1033P T C missense Het probably damaging 0.999 phenotype 07/06/2016
25 398298 UTSW Ovol3 0.206 R5235 G1 225 N 7 30233474 Y179N A T missense Het possibly damaging 0.953 07/06/2016
26 486779 UTSW Papss2 0.159 R5235 G1 225 N 19 32639219 N215S A G missense Het probably benign 0.001 phenotype 08/17/2017
27 398332 UTSW Pcdhga8 0.135 R5235 G1 225 N 18 37727435 Y515H T C missense Het probably damaging 1.000 phenotype 07/06/2016
28 398315 UTSW Phlda1 0.000 R5235 G1 138 N 10 111507391 CCAGCCCCAACCTCAGCCCCAACCTCAGCCCCAACC CCAGCCCCAACCTCAGCCCCAACC small deletion Het probably benign phenotype 07/06/2016
29 398266 UTSW Scn2a 1.000 R5235 G1 225 N 2 65752011 N1568Y A T missense Het probably damaging 1.000 phenotype 07/06/2016
30 398264 UTSW Sec16b 0.129 R5235 G1 225 N 1 157534764 I251F A T missense Het probably benign 0.005 phenotype 07/06/2016
31 398294 UTSW Slc29a4 0.000 R5235 G1 225 N 5 142718768 I355N T A missense Het probably damaging 0.997 phenotype 07/06/2016
32 398326 UTSW Snx29 0.118 R5235 G1 224 N 16 11413246 C39F G T missense Het possibly damaging 0.942 07/06/2016
33 398275 UTSW Spata16 0.178 R5235 G1 225 N 3 26667632 M101V A G missense Het probably benign 0.004 phenotype 07/06/2016
34 398317 UTSW Stat2 0.276 R5235 G1 225 N 10 128291032 T C critical splice donor site 2 bp Het probably null phenotype 07/06/2016
35 398318 UTSW Tnrc6c 0.000 R5235 G1 153 N 11 117760729 V1693F G T missense Het probably benign 0.416 phenotype 07/06/2016
36 398278 UTSW Tpm3 1.000 R5235 G1 225 N 3 90086495 E97G A G missense Het probably damaging 0.997 phenotype 07/06/2016
37 398281 UTSW Ugt8a 0.375 R5235 G1 225 N 3 125867480 H454Q A C missense Het probably damaging 0.999 phenotype 07/06/2016
38 398297 UTSW Vmn2r27 0.069 R5235 G1 225 N 6 124192054 I706L T A missense Het probably damaging 0.987 07/06/2016
39 398290 UTSW Wdfy3 0.877 R5235 G1 225 N 5 101847106 I3256V T C missense Het probably null 0.026 phenotype 07/06/2016
[records 1 to 39 of 39]