Incidental Mutations

127 incidental mutations are currently displayed, and affect 126 genes.
25 are Possibly Damaging.
56 are Probably Damaging.
31 are Probably Benign.
15 are Probably Null.
4 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 127] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 424979 UTSW 4833420G17Rik 0.000 R5384 G1 225 N 13 119469960 V246A T C missense Het probably benign 0.009 08/04/2016
2 425001 UTSW Abcc10 0.107 R5384 G1 225 N 17 46304435 S1343G T C missense Het possibly damaging 0.830 phenotype 08/04/2016
3 424906 UTSW Abcd3 0.000 R5384 G1 225 N 3 121761410 C A splice site 5 bp Het probably null phenotype 08/04/2016
4 424899 UTSW Actl6a 1.000 R5384 G1 225 N 3 32720493 M335K T A missense Het probably damaging 0.998 phenotype 08/04/2016
5 424925 UTSW Adamts9 1.000 R5384 G1 225 N 6 92798018 C1090W A C missense Het probably damaging 1.000 phenotype 08/04/2016
6 424984 UTSW Ajuba 0.000 R5384 G1 225 N 14 54570398 Y459C T C missense Het probably damaging 1.000 phenotype 08/04/2016
7 425009 UTSW Aldh7a1 0.181 R5384 G1 225 N 18 56534253 N316Y T A missense Het possibly damaging 0.851 phenotype 08/04/2016
8 425006 UTSW Ankhd1 0.000 R5384 G1 225 N 18 36591495 E402G A G missense Het probably damaging 0.997 08/04/2016
9 424953 UTSW Ankrd36 0.055 R5384 G1 225 N 11 5689340 A G unclassified Het probably benign 08/04/2016
10 424944 UTSW Apeh 0.000 R5384 G1 225 N 9 108086463 L551H A T missense Het probably damaging 1.000 phenotype 08/04/2016
11 424952 UTSW Avpr1a 0.098 R5384 G1 225 N 10 122449369 F189I T A missense Het probably damaging 0.999 phenotype 08/04/2016
12 424887 UTSW BC034090 0.066 R5384 G1 225 N 1 155242027 H115L T A missense Het possibly damaging 0.675 08/04/2016
13 424998 UTSW C4b 0.000 R5384 G1 225 N 17 34737661 D654E A T missense Het possibly damaging 0.895 phenotype 08/04/2016
14 425012 UTSW Carns1 0.121 R5384 G1 225 N 19 4171901 T A critical splice acceptor site Het probably null phenotype 08/04/2016
15 424915 UTSW Ccdc146 0.000 R5384 G1 225 N 5 21308713 E469V T A missense Het probably benign 0.370 phenotype 08/04/2016
16 500959 UTSW Cdc27 0.965 R5384 G1 225 N 11 104507140 I804T A G missense Het probably benign 0.018 phenotype 12/01/2017
17 424949 UTSW Cdh23 0.406 R5384 G1 225 N 10 60337762 T1651I G A missense Het probably damaging 0.989 phenotype 08/04/2016
18 424972 UTSW Cenpo 1.000 R5384 G1 225 N 12 4216646 P154L G A missense Het probably damaging 1.000 phenotype 08/04/2016
19 424938 UTSW Cenpu 1.000 R5384 G1 208 N 8 46562499 G150R G A missense Het probably benign 0.000 phenotype 08/04/2016
20 424933 UTSW Chrna10 0.186 R5384 G1 225 N 7 102114353 L78F C A missense Het probably damaging 0.974 phenotype 08/04/2016
21 424961 UTSW Chrne 0.117 R5384 G1 225 N 11 70615087 N457K A T missense Het possibly damaging 0.633 phenotype 08/04/2016
22 425011 UTSW Cidea 0.268 R5384 G1 225 N 18 67360166 D85V A T missense Het probably damaging 1.000 phenotype 08/04/2016
23 424943 UTSW Cldn18 0.000 R5384 G1 225 N 9 99709858 S31G T C missense Het possibly damaging 0.929 phenotype 08/04/2016
24 424931 UTSW Clpb 0.880 R5384 G1 225 N 7 101779341 I436N T A missense Het probably damaging 1.000 phenotype 08/04/2016
25 424997 UTSW Col11a2 0.883 R5384 G1 225 N 17 34059174 T C critical splice donor site 2 bp Het probably null phenotype 08/04/2016
26 425002 UTSW Cul7 1.000 R5384 G1 225 N 17 46654477 V527A T C missense Het probably benign 0.444 phenotype 08/04/2016
27 424935 UTSW Dchs1 1.000 R5384 G1 225 N 7 105758029 V2119G A C missense Het probably damaging 1.000 phenotype 08/04/2016
28 424936 UTSW Dchs1 1.000 R5384 G1 225 N 7 105772055 D386V T A missense Het probably damaging 1.000 phenotype 08/04/2016
29 424990 UTSW Dcstamp 0.513 R5384 G1 225 N 15 39759319 Q345H A C missense Het probably damaging 0.985 phenotype 08/04/2016
30 424910 UTSW Dlgap3 0.097 R5384 G1 151 N 4 127236330 I955V A G missense Het probably damaging 0.998 phenotype 08/04/2016
31 424914 UTSW Dvl1 0.000 R5384 G1 225 N 4 155853686 D97G A G missense Het probably damaging 0.993 phenotype 08/04/2016
32 424939 UTSW Dync2h1 1.000 R5384 G1 225 N 9 7016791 D3573G T C missense Het probably damaging 0.994 phenotype 08/04/2016
33 424971 UTSW Efr3b 0.000 R5384 G1 225 N 12 3983419 F129L G T missense Het probably benign 0.044 08/04/2016
34 424956 UTSW Etaa1 0.000 R5384 G1 225 N 11 17947539 L193F G A missense Het probably damaging 1.000 08/04/2016
35 424951 UTSW Fam13c 0.203 R5384 G1 225 N 10 70553069 S474N G A missense Het probably benign 0.029 08/04/2016
36 424967 UTSW Fam171a2 0.154 R5384 G1 114 N 11 102437867 V689L C A missense Het possibly damaging 0.511 08/04/2016
37 424978 UTSW Fastkd3 0.113 R5384 G1 225 N 13 68584585 F342L T C missense Het probably benign 0.094 phenotype 08/04/2016
38 424900 UTSW Fat4 1.000 R5384 G1 225 N 3 38995946 S3986P T C missense Het possibly damaging 0.872 phenotype 08/04/2016
39 425010 UTSW Fbxo38 0.000 R5384 G1 225 N 18 62540971 M13T A G missense Het probably benign 0.000 08/04/2016
40 424955 UTSW Fbxo48 0.090 R5384 G1 225 N 11 16954329 L160F G T missense Het possibly damaging 0.710 08/04/2016
41 424912 UTSW Fgr 0.176 R5384 G1 225 N 4 132986353 G A critical splice donor site 1 bp Het probably null phenotype 08/04/2016
42 424886 UTSW Gbx2 1.000 R5384 G1 225 N 1 89928913 T252A T C missense Het probably damaging 1.000 phenotype 08/04/2016
43 424916 UTSW Gm20671 0.198 R5384 G1 225 N 5 32819942 S1823P A G missense Het probably damaging 1.000 08/04/2016
44 424968 UTSW Gpatch8 0.371 R5384 G1 225 N 11 102508227 A T intron Het probably null phenotype 08/04/2016
45 424965 UTSW Gsdma 0.051 R5384 G1 225 N 11 98666449 A T critical splice acceptor site Het probably null 08/04/2016
46 425015 UTSW Gucy2g 0.000 R5384 G1 225 N 19 55215116 A750V G A missense Het probably damaging 1.000 phenotype 08/04/2016
47 424973 UTSW Hdac9 0.000 R5384 G1 225 N 12 34429558 Y223H A G missense Het probably damaging 1.000 phenotype 08/04/2016
48 424994 UTSW Igsf5 0.053 R5384 G1 225 N 16 96391026 T275N C A missense Het probably benign 0.210 phenotype 08/04/2016
49 424923 UTSW Il23r 0.000 R5384 G1 225 N 6 67486291 H73Y G A missense Het probably benign 0.103 phenotype 08/04/2016
50 424985 UTSW Ipo4 0.178 R5384 G1 225 N 14 55626196 R1026S G T missense Het probably benign 0.280 08/04/2016
51 424901 UTSW Jade1 0.000 R5384 G1 225 N 3 41591702 I54N T A missense Het probably damaging 1.000 phenotype 08/04/2016
52 424911 UTSW Khdrbs1 0.700 R5384 G1 204 N 4 129741936 D75E G T missense Het possibly damaging 0.705 phenotype 08/04/2016
53 424920 UTSW Lrwd1 0.864 R5384 G1 225 N 5 136123874 D511E A T missense Het possibly damaging 0.841 phenotype 08/04/2016
54 424891 UTSW Ly75 0.000 R5384 G1 225 N 2 60334487 C782* A T nonsense Het probably null phenotype 08/04/2016
55 424940 UTSW Mmp3 0.100 R5384 G1 225 N 9 7451759 R366* C T nonsense Het probably null phenotype 08/04/2016
56 424930 UTSW Mrgpra6 0.051 R5384 G1 225 N 7 47188881 C190R A G missense Het probably damaging 1.000 08/04/2016
57 424960 UTSW Myh10 1.000 R5384 G1 225 N 11 68801608 L1369Q T A missense Het probably damaging 1.000 phenotype 08/04/2016
58 425013 UTSW Myof 0.000 R5384 G1 225 N 19 37952987 A792T C T missense Het probably damaging 0.978 phenotype 08/04/2016
59 424919 UTSW Ncf1 0.000 R5384 G1 225 N 5 134221805 L373P A G missense Het probably damaging 0.999 phenotype 08/04/2016
60 424948 UTSW Ncoa7 0.000 R5384 G1 225 N 10 30722817 A37S C A missense Het probably benign 0.005 08/04/2016
61 424907 UTSW Nfkb1 0.000 R5384 G1 225 N 3 135612542 V310A A G missense Het possibly damaging 0.949 phenotype 08/04/2016
62 424958 UTSW Nmur2 0.137 R5384 G1 225 N 11 56040214 I224F T A missense Het probably damaging 0.995 phenotype 08/04/2016
63 424980 UTSW Nr1d2 0.000 R5384 G1 225 N 14 18211922 S394T A T missense Het probably benign 0.083 phenotype 08/04/2016
64 425004 UTSW Nudt12 0.000 R5384 G1 225 N 17 59003439 W390R A G missense Het probably damaging 1.000 phenotype 08/04/2016
65 424895 UTSW Olfr1252 0.429 R5384 G1 225 N 2 89721305 I269F T A missense Het possibly damaging 0.935 phenotype 08/04/2016
66 424983 UTSW Olfr1508 0.060 R5384 G1 225 N 14 52463257 T251S T A missense Het probably benign 0.408 phenotype 08/04/2016
67 424993 UTSW Olfr165 0.060 R5384 G1 225 N 16 19407797 L73P A G missense Het probably damaging 0.996 phenotype 08/04/2016
68 424934 UTSW Olfr243 0.083 R5384 G1 225 N 7 103717355 F254L T C missense Het probably benign 0.119 phenotype 08/04/2016
69 424981 UTSW Olfr739 0.060 R5384 G1 225 N 14 50425389 V290E T A missense Het possibly damaging 0.775 phenotype 08/04/2016
70 424942 UTSW Pate2 0.000 R5384 G1 225 N 9 35670541 M44V A G missense Het probably damaging 0.980 08/04/2016
71 424885 UTSW Pikfyve 1.000 R5384 G1 225 N 1 65244409 L735S T C missense Het probably damaging 1.000 phenotype 08/04/2016
72 425014 UTSW Plce1 0.640 R5384 G1 225 N 19 38760091 N1755K C A missense Het probably damaging 1.000 phenotype 08/04/2016
73 424898 UTSW Pld1 0.000 R5384 G1 225 N 3 28025320 R90S C A missense Het probably damaging 0.999 phenotype 08/04/2016
74 424890 UTSW Pnpla7 0.131 R5384 G1 225 N 2 25041019 P882Q C A missense Het probably damaging 0.966 phenotype 08/04/2016
75 424954 UTSW Pold2 1.000 R5384 G1 225 N 11 5876760 L58P A G missense Het probably damaging 1.000 0.466 phenotype 08/04/2016
76 424963 UTSW Ppm1d 1.000 R5384 G1 111 N 11 85311783 E104G A G missense Het probably damaging 0.984 phenotype 08/04/2016
77 424964 UTSW Ppm1e 0.443 R5384 G1 170 N 11 87358551 L118Q A T missense Het possibly damaging 0.956 phenotype 08/04/2016
78 424884 UTSW Ppp1r42 0.000 R5384 G1 225 N 1 9999435 L134P A G missense Het probably damaging 1.000 phenotype 08/04/2016
79 424962 UTSW Prpf8 0.961 R5384 G1 225 N 11 75495799 D1038G A G missense Het probably damaging 0.999 phenotype 08/04/2016
80 424937 UTSW Prss36 0.000 R5384 G1 225 N 7 127936699 R288L C A missense Het probably damaging 0.999 08/04/2016
81 424988 UTSW Prss51 0.204 R5384 G1 225 N 14 64097094 V108E T A missense Het probably damaging 0.994 08/04/2016
82 500961 UTSW Psma3 0.949 R5384 G1 145 N 12 70974765 G7W G T missense Het probably damaging 1.000 phenotype 12/01/2017
83 424966 UTSW Psmc3ip 0.000 R5384 G1 225 N 11 101092604 A T splice site Het probably null phenotype 08/04/2016
84 424896 UTSW Qser1 0.469 R5384 G1 225 N 2 104786642 E1275G T C missense Het probably damaging 0.996 08/04/2016
85 425018 UTSW Rai2 R5384 G1 222 N X 161778640 N363S A G missense Het probably benign 0.000 phenotype 08/04/2016
86 424957 UTSW Ranbp17 0.000 R5384 G1 225 N 11 33219241 V991D A T missense Het possibly damaging 0.751 phenotype 08/04/2016
87 424913 UTSW Rcc2 0.000 R5384 G1 225 N 4 140720566 K468* A T nonsense Het probably null phenotype 08/04/2016
88 424941 UTSW S1pr2 0.173 R5384 G1 225 N 9 20967594 T313A T C missense Het probably benign 0.000 phenotype 08/04/2016
89 424929 UTSW Sec1 0.000 R5384 G1 225 N 7 45678840 R261L C A missense Het probably benign 0.117 phenotype 08/04/2016
90 500958 UTSW Sfi1 0.243 R5384 G1 195 N 11 3153382 ACA ACATCTTCCCAAAGCCAGTCA intron Homo probably benign 12/01/2017
91 424909 UTSW Sgip1 0.000 R5384 G1 225 N 4 102934566 V362I G A missense Het possibly damaging 0.455 phenotype 08/04/2016
92 425016 UTSW Shroom4 0.000 R5384 G1 222 N X 6585469 C894* T A nonsense Het probably null phenotype 08/04/2016
93 424921 UTSW Slc12a9 0.226 R5384 G1 225 N 5 137331014 L126Q A T missense Het probably damaging 1.000 08/04/2016
94 424992 UTSW Slx4 1.000 R5384 G1 225 N 16 3990805 S424P A G missense Het probably damaging 1.000 phenotype 08/04/2016
95 424903 UTSW Smg5 1.000 R5384 G1 225 N 3 88351293 S524P T C missense Het probably damaging 1.000 phenotype 08/04/2016
96 425008 UTSW Sncaip 0.183 R5384 G1 225 N 18 52885041 D418G A G missense Het probably damaging 0.999 phenotype 08/04/2016
97 424947 UTSW Soga3 0.250 R5384 G1 225 N 10 29196770 D686G A G missense Het probably benign 0.004 08/04/2016
98 424977 UTSW Spata31d1b 0.082 R5384 G1 225 N 13 59718218 T1060K C A missense Het possibly damaging 0.675 08/04/2016
99 425007 UTSW Spink6 0.090 R5384 G1 225 N 18 44082280 T66A A G missense Het probably damaging 1.000 08/04/2016
100 424969 UTSW Sppl2c 0.112 R5384 G1 225 N 11 104187301 I309K T A missense Het possibly damaging 0.683 08/04/2016
[records 1 to 100 of 127] next >> last >|