Incidental Mutations

130 incidental mutations are currently displayed, and affect 130 genes.
26 are Possibly Damaging.
45 are Probably Damaging.
44 are Probably Benign.
15 are Probably Null.
9 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 130] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 425108 UTSW Abhd17a 0.000 R5385 G1 225 N 10 80585612 T175A T C missense Het probably benign 0.203 08/04/2016
2 425023 UTSW Adam23 1.000 R5385 G1 225 N 1 63551811 D479G A G missense Het possibly damaging 0.735 phenotype 08/04/2016
3 425061 UTSW Adgrl3 0.000 R5385 G1 225 N 5 81726801 Y1050D T G missense Het probably damaging 0.999 phenotype 08/04/2016
4 500963 UTSW Ago4 0.394 R5385 G1 225 N 4 126517556 I103T A G missense Het probably benign 0.000 phenotype 12/01/2017
5 425134 UTSW Ajuba 0.000 R5385 G1 225 N 14 54570398 Y459C T C missense Het probably damaging 1.000 phenotype 08/04/2016
6 425155 UTSW Aldh7a1 0.181 R5385 G1 225 N 18 56534253 N316Y T A missense Het possibly damaging 0.851 phenotype 08/04/2016
7 425027 UTSW Alyref2 0.845 R5385 G1 203 N 1 171503703 N16S A G missense Het probably benign 0.290 08/04/2016
8 425154 UTSW Ankhd1 0.000 R5385 G1 225 N 18 36591495 E402G A G missense Het probably damaging 0.997 08/04/2016
9 425113 UTSW Ankrd36 0.055 R5385 G1 225 N 11 5689340 A G unclassified Het probably benign 08/04/2016
10 500966 UTSW Ap2b1 1.000 R5385 G1 207 N 11 83342601 V480A T C missense Het probably damaging 0.997 phenotype 12/01/2017
11 425026 UTSW Arhgap30 0.000 R5385 G1 225 N 1 171408280 R741G A G missense Het probably benign 0.000 08/04/2016
12 425117 UTSW Canx 0.536 R5385 G1 225 N 11 50301812 L325P A G missense Het probably damaging 1.000 phenotype 08/04/2016
13 425101 UTSW Ccpg1 0.000 R5385 G1 225 N 9 73013044 S647N G A missense Het probably benign 0.000 08/04/2016
14 425159 UTSW Cdc37l1 0.000 R5385 G1 225 N 19 29011943 S267A T G missense Het possibly damaging 0.946 phenotype 08/04/2016
15 425084 UTSW Ces1f 0.064 R5385 G1 225 N 8 93265760 C354* A T nonsense Het probably null 08/04/2016
16 425128 UTSW Col4a3bp 1.000 R5385 G1 225 N 13 96629067 T447A A G missense Het possibly damaging 0.941 phenotype 08/04/2016
17 500962 UTSW Cpne1 0.708 R5385 G1 225 N 2 156074364 V350D A T missense Het probably damaging 0.986 phenotype 12/01/2017
18 425111 UTSW Ctdsp2 0.635 R5385 G1 173 N 10 126996457 T262A A G missense Het probably benign 0.000 08/04/2016
19 425091 UTSW Cypt4 0.078 R5385 G1 225 N 9 24625300 K29E A G missense Het possibly damaging 0.659 08/04/2016
20 425073 UTSW Dlg2 0.000 R5385 G1 225 N 7 92088576 V422A T C missense Het probably damaging 0.959 phenotype 08/04/2016
21 425098 UTSW Dmxl2 1.000 R5385 G1 225 N 9 54378757 S2715P A G missense Het probably benign 0.000 phenotype 08/04/2016
22 425076 UTSW Dnah3 0.108 R5385 G1 225 N 7 119924903 K3953N T A missense Het probably damaging 0.999 phenotype 08/04/2016
23 425089 UTSW Dnmt1 1.000 R5385 G1 225 N 9 20918480 V647A A G missense Het probably damaging 1.000 phenotype 08/04/2016
24 425047 UTSW Duox2 0.000 R5385 G1 225 N 2 122295136 V330A A G missense Het probably benign 0.000 phenotype 08/04/2016
25 425081 UTSW Dusp8 0.126 R5385 G1 180 N 7 142089993 Q61L T A missense Het possibly damaging 0.953 phenotype 08/04/2016
26 425086 UTSW Dync2h1 1.000 R5385 G1 225 N 9 7016791 D3573G T C missense Het probably damaging 0.994 phenotype 08/04/2016
27 425078 UTSW Ears2 1.000 R5385 G1 225 N 7 122044377 T426S G C missense Het probably benign 0.357 phenotype 08/04/2016
28 425141 UTSW Ext1 1.000 R5385 G1 225 N 15 53075817 W612L C A missense Het probably damaging 0.996 phenotype 08/04/2016
29 425142 UTSW Fam91a1 0.000 R5385 G1 225 N 15 58448394 S645N G A missense Het probably benign 0.000 phenotype 08/04/2016
30 425088 UTSW Fat3 0.606 R5385 G1 225 N 9 15922675 L4207Q A T missense Het possibly damaging 0.820 phenotype 08/04/2016
31 425156 UTSW Fbxo38 0.000 R5385 G1 225 N 18 62540971 M13T A G missense Het probably benign 0.000 08/04/2016
32 425115 UTSW Fbxo48 0.090 R5385 G1 225 N 11 16954329 L160F G T missense Het possibly damaging 0.710 08/04/2016
33 425051 UTSW Fer1l4 0.000 R5385 G1 195 N 2 156037366 Q906* G A nonsense Het probably null 08/04/2016
34 425148 UTSW Fpr2 0.082 R5385 G1 225 N 17 17893047 H102N C A missense Het probably benign 0.005 phenotype 08/04/2016
35 425033 UTSW Gm10134 0.054 R5385 G1 225 N 2 28506360 T A unclassified Het probably benign 08/04/2016
36 425048 UTSW Gm14085 0.071 R5385 G1 225 N 2 122522778 L480I C A missense Het probably benign 0.010 08/04/2016
37 425035 UTSW Gpr107 1.000 R5385 G1 225 N 2 31214251 T523A A G missense Het probably benign 0.015 phenotype 08/04/2016
38 425058 UTSW Grin3a 0.000 R5385 G1 225 N 4 49719313 P811L G A missense Het probably damaging 1.000 phenotype 08/04/2016
39 425125 UTSW Hivep1 0.561 R5385 G1 225 N 13 42164395 A T splice site 3 bp Het probably null phenotype 08/04/2016
40 425036 UTSW Hmcn2 0.000 R5385 G1 186 N 2 31460321 T5077A A G missense Het probably benign 0.113 08/04/2016
41 425062 UTSW Hpse 0.000 R5385 G1 225 N 5 100708724 W136* C T nonsense Het probably null phenotype 08/04/2016
42 425080 UTSW Ifitm3 0.000 R5385 G1 225 N 7 141010641 N2S T C missense Het probably benign 0.001 phenotype 08/04/2016
43 425147 UTSW Ifnar2 0.080 R5385 G1 225 N 16 91404198 D442E T A missense Het possibly damaging 0.705 phenotype 08/04/2016
44 425053 UTSW Jade1 0.000 R5385 G1 225 N 3 41591702 I54N T A missense Het probably damaging 1.000 phenotype 08/04/2016
45 425050 UTSW Jag1 1.000 R5385 G1 170 N 2 137095544 H303Q A T missense Het possibly damaging 0.755 phenotype 08/04/2016
46 425120 UTSW Kcnh4 0.000 R5385 G1 200 N 11 100752250 D397G T C missense Het probably damaging 0.997 phenotype 08/04/2016
47 425092 UTSW Kcnj1 0.087 R5385 G1 225 N 9 32396723 R148G A G missense Het probably damaging 1.000 phenotype 08/04/2016
48 425025 UTSW Lct 0.000 R5385 G1 225 N 1 128311617 K277N T G missense Het possibly damaging 0.633 phenotype 08/04/2016
49 425068 UTSW Loxl3 0.891 R5385 G1 225 N 6 83050612 M712V A G missense Het probably damaging 0.993 phenotype 08/04/2016
50 425041 UTSW Ly75 0.000 R5385 G1 225 N 2 60303641 C1547R A G missense Het probably damaging 1.000 phenotype 08/04/2016
51 425105 UTSW Marcks 0.000 R5385 G1 225 N 10 37138457 S27P A G missense Het probably damaging 0.998 phenotype 08/04/2016
52 425127 UTSW Mef2c 1.000 R5385 G1 225 N 13 83662413 T347A A G missense Het probably benign 0.195 phenotype 08/04/2016
53 425087 UTSW Mmp3 0.100 R5385 G1 225 N 9 7451759 R366* C T nonsense Het probably null phenotype 08/04/2016
54 425072 UTSW Mrgprx2 0.061 R5385 G1 225 N 7 48483005 T22A T C missense Het probably benign 0.109 08/04/2016
55 425020 UTSW Msc 0.253 R5385 G1 207 N 1 14755420 R110L C A missense Het probably damaging 0.995 phenotype 08/04/2016
56 425144 UTSW Myh11 1.000 R5385 G1 225 N 16 14208008 V1366D A T missense Het possibly damaging 0.659 phenotype 08/04/2016
57 425066 UTSW Ncf1 0.000 R5385 G1 225 N 5 134221805 L373P A G missense Het probably damaging 0.999 phenotype 08/04/2016
58 425040 UTSW Neb 0.806 R5385 G1 225 N 2 52189861 I85N A T missense Het probably damaging 0.993 phenotype 08/04/2016
59 425057 UTSW Nfkb1 0.000 R5385 G1 225 N 3 135612542 V310A A G missense Het possibly damaging 0.949 phenotype 08/04/2016
60 425069 UTSW Nop2 0.967 R5385 G1 225 N 6 125144361 V702A T C missense Het probably benign 0.000 phenotype 08/04/2016
61 425152 UTSW Nudt12 0.000 R5385 G1 225 N 17 59003439 W390R A G missense Het probably damaging 1.000 phenotype 08/04/2016
62 425043 UTSW Olfr1115 0.069 R5385 G1 225 N 2 87252483 P182L C T missense Het probably benign 0.059 phenotype 08/04/2016
63 425158 UTSW Olfr1418 0.060 R5385 G1 225 N 19 11855177 I259F T A missense Het probably damaging 0.998 phenotype 08/04/2016
64 425093 UTSW Olfr160 0.000 R5385 G1 225 N 9 37712021 V86E A T missense Het probably damaging 0.999 phenotype 08/04/2016
65 425094 UTSW Olfr251 0.068 R5385 G1 225 N 9 38377985 I29F A T missense Het probably benign 0.000 phenotype 08/04/2016
66 425039 UTSW Olfr366 0.092 R5385 G1 225 N 2 37219587 A33S G T missense Het possibly damaging 0.775 phenotype 08/04/2016
67 425028 UTSW Olfr430 0.105 R5385 G1 225 N 1 174069470 K57N A T missense Het probably benign 0.306 phenotype 08/04/2016
68 425075 UTSW Olfr558 0.061 R5385 G1 225 N 7 102709346 L29P T C missense Het probably damaging 0.999 phenotype 08/04/2016
69 425132 UTSW Olfr739 0.060 R5385 G1 225 N 14 50425389 V290E T A missense Het possibly damaging 0.775 phenotype 08/04/2016
70 425112 UTSW Olfr784 0.071 R5385 G1 225 N 10 129387764 I44V A G missense Het probably benign 0.052 phenotype 08/04/2016
71 425095 UTSW Olfr971 0.084 R5385 G1 225 N 9 39839830 Y132C A G missense Het possibly damaging 0.946 phenotype 08/04/2016
72 425123 UTSW Otub2 0.092 R5385 G1 225 N 12 103392796 G A intron Het probably benign phenotype 08/04/2016
73 425136 UTSW Pck2 0.190 R5385 G1 225 N 14 55545231 E339G A G missense Het probably damaging 1.000 phenotype 08/04/2016
74 425100 UTSW Pdcd7 0.208 R5385 G1 225 N 9 65358692 W477* G A nonsense Het probably null phenotype 08/04/2016
75 425149 UTSW Pdpk1 1.000 R5385 G1 225 N 17 24098140 Q250* G A nonsense Het probably null phenotype 08/04/2016
76 425102 UTSW Pigb 0.870 R5385 G1 225 N 9 73039545 H16L T A missense Het probably benign 0.055 phenotype 08/04/2016
77 425157 UTSW Pitpnm1 0.000 R5385 G1 225 N 19 4103435 F197S T C missense Het probably damaging 0.987 phenotype 08/04/2016
78 425153 UTSW Plekhh2 0.116 R5385 G1 225 N 17 84557466 V94A T C missense Het probably benign 0.002 08/04/2016
79 425031 UTSW Pnpla7 0.131 R5385 G1 225 N 2 25041019 P882Q C A missense Het probably damaging 0.966 phenotype 08/04/2016
80 425114 UTSW Pold2 1.000 R5385 G1 225 N 11 5876760 L58P A G missense Het probably damaging 1.000 0.466 phenotype 08/04/2016
81 425038 UTSW Pomt1 0.118 R5385 G1 225 N 2 32244299 Y277* C G nonsense Het probably null phenotype 08/04/2016
82 425019 UTSW Prex2 0.190 R5385 G1 225 N 1 11139980 D548G A G missense Het probably damaging 0.994 phenotype 08/04/2016
83 425042 UTSW Prkra 0.530 R5385 G1 225 N 2 76639278 T146P T G missense Het probably damaging 0.992 phenotype 08/04/2016
84 425139 UTSW Prss51 0.204 R5385 G1 225 N 14 64097094 V108E T A missense Het probably damaging 0.994 08/04/2016
85 425162 UTSW Rai2 R5385 G1 222 N X 161778640 N363S A G missense Het probably benign 0.000 phenotype 08/04/2016
86 425116 UTSW Ranbp17 0.000 R5385 G1 225 N 11 33219241 V991D A T missense Het possibly damaging 0.751 phenotype 08/04/2016
87 425146 UTSW Riox2 0.798 R5385 G1 225 N 16 59486616 M290K T A missense Het probably benign 0.329 phenotype 08/04/2016
88 425024 UTSW Rnpepl1 0.000 R5385 G1 225 N 1 92917192 L402Q T A missense Het probably damaging 1.000 08/04/2016
89 425090 UTSW S1pr2 0.173 R5385 G1 225 N 9 20967594 T313A T C missense Het probably benign 0.000 phenotype 08/04/2016
90 425059 UTSW Sesn2 0.242 R5385 G1 225 N 4 132499264 I173T A G missense Het probably damaging 0.991 phenotype 08/04/2016
91 425034 UTSW Setx 0.000 R5385 G1 225 N 2 29134033 T G critical splice donor site 2 bp Het probably null phenotype 08/04/2016
92 500965 UTSW Sfi1 0.243 R5385 G1 143 N 11 3153382 ACA ACATCTTCCCAAAGCCAGTCA intron Het probably benign 12/01/2017
93 425143 UTSW Sgsm3 0.220 R5385 G1 225 N 15 81007999 V256A T C missense Het probably benign 0.005 08/04/2016
94 425160 UTSW Shroom4 0.000 R5385 G1 222 N X 6585469 C894* T A nonsense Het probably null phenotype 08/04/2016
95 425119 UTSW Slc13a5 0.000 R5385 G1 225 N 11 72259077 E159D T A missense Het probably benign 0.012 phenotype 08/04/2016
96 425110 UTSW Slc16a7 0.060 R5385 G1 225 N 10 125294604 Y71H A G missense Het possibly damaging 0.854 phenotype 08/04/2016
97 425130 UTSW Slc4a7 0.898 R5385 G1 225 N 14 14773345 F772L T C missense Het possibly damaging 0.936 phenotype 08/04/2016
98 425032 UTSW Snapc4 1.000 R5385 G1 225 N 2 26374503 S275P A G missense Het probably benign 0.442 phenotype 08/04/2016
99 425104 UTSW Soga3 0.250 R5385 G1 225 N 10 29196770 D686G A G missense Het probably benign 0.004 08/04/2016
100 425096 UTSW Sorl1 0.497 R5385 G1 225 N 9 42057284 T558A T C missense Het possibly damaging 0.826 phenotype 08/04/2016
[records 1 to 100 of 130] next >> last >|