Incidental Mutations

59 incidental mutations are currently displayed, and affect 59 genes.
6 are Possibly Damaging.
26 are Probably Damaging.
19 are Probably Benign.
8 are Probably Null.
4 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 59 of 59] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 438038 UTSW 9930111J21Rik2 0.282 R5611 G1 225 N 11 49020001 T535R G C missense Het possibly damaging 0.911 10/26/2016
2 438031 UTSW Adam34 0.142 R5611 G1 225 N 8 43651712 F299I A T missense Het probably benign 0.430 10/26/2016
3 438048 UTSW Adamts20 0.239 R5611 G1 225 N 15 94273280 M1854T A G missense Het possibly damaging 0.650 phenotype 10/26/2016
4 438029 UTSW Apbb1 0.000 R5611 G1 225 N 7 105559483 V581A A G missense Het probably damaging 1.000 phenotype 10/26/2016
5 438047 UTSW Apol6 0.031 R5611 G1 225 N 15 77051040 T A unclassified Het probably null phenotype 10/26/2016
6 438056 UTSW Arhgef37 0.258 R5611 G1 225 N 18 61507263 T242A T C missense Het probably benign 0.025 10/26/2016
7 438040 UTSW Asxl2 0.918 R5611 G1 225 N 12 3484598 V265A T C missense Het probably damaging 1.000 phenotype 10/26/2016
8 438022 UTSW Bicd1 0.398 R5611 G1 225 N 6 149513456 R556* A T nonsense Het probably null phenotype 10/26/2016
9 438053 UTSW C2 0.296 R5611 G1 225 N 17 34872384 I101T A G missense Het probably damaging 0.993 phenotype 10/26/2016
10 438024 UTSW Cd22 0.000 R5611 G1 113 N 7 30878150 T A unclassified Het probably benign phenotype 10/26/2016
11 438026 UTSW Cd33 0.000 R5611 G1 225 N 7 43532118 H206R T C missense Het probably damaging 0.969 phenotype 10/26/2016
12 438009 UTSW Cd5l 0.000 R5611 G1 225 N 3 87367775 G207D G A missense Het possibly damaging 0.640 phenotype 10/26/2016
13 438049 UTSW Chrd 1.000 R5611 G1 225 N 16 20738974 D774V A T missense Het probably damaging 0.995 phenotype 10/26/2016
14 438032 UTSW Cmtm1 0.405 R5611 G1 123 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 10/26/2016
15 438016 UTSW Csn1s1 0.000 R5611 G1 225 N 5 87677644 A T splice site 4 bp Het probably null phenotype 10/26/2016
16 438011 UTSW Dpyd 0.276 R5611 G1 225 N 3 119194293 V704I G A missense Het probably benign 0.000 phenotype 10/26/2016
17 438046 UTSW Dscc1 0.897 R5611 G1 225 N 15 55082173 Q312H C A missense Het probably benign 0.232 phenotype 10/26/2016
18 501155 UTSW Dysf 0.000 R5611 G1 169 N 6 84064878 T154S A T missense Het probably damaging 0.976 phenotype 12/01/2017
19 438030 UTSW Foxi2 0.130 R5611 G1 225 N 7 135411704 V221A T C missense Het probably benign 0.004 phenotype 10/26/2016
20 438012 UTSW Gabbr2 0.363 R5611 G1 218 N 4 46804105 I250N A T missense Het probably damaging 0.981 phenotype 10/26/2016
21 438039 UTSW Gfap 0.153 R5611 G1 202 N 11 102897069 T17S T A missense Het probably benign 0.001 phenotype 10/26/2016
22 438010 UTSW Gm9774 0.290 R5611 G1 225 N 3 92428451 P315S G A missense Het probably damaging 1.000 10/26/2016
23 438034 UTSW Hcrtr2 0.149 R5611 G1 225 N 9 76323314 V64A A G missense Het probably damaging 0.976 phenotype 10/26/2016
24 438020 UTSW Igkv4-86 R5611 G1 225 N 6 68910675 S27P A G missense Het probably damaging 1.000 10/26/2016
25 438050 UTSW Kalrn 0.879 R5611 G1 225 N 16 34175780 F903L G T missense Het probably damaging 1.000 phenotype 10/26/2016
26 438007 UTSW Lrrc31 0.106 R5611 G1 225 N 3 30691155 A G critical splice donor site 2 bp Het probably null 10/26/2016
27 438041 UTSW Mlh3 0.000 R5611 G1 225 N 12 85267445 T656A T C missense Het probably benign 0.207 phenotype 10/26/2016
28 438044 UTSW Mss51 0.463 R5611 G1 225 N 14 20483106 S432R G T missense Het possibly damaging 0.691 10/26/2016
29 438023 UTSW Mzf1 0.470 R5611 G1 225 N 7 13044627 A G utr 3 prime Het probably benign phenotype 10/26/2016
30 457993 UTSW Nop58 0.972 R5611 G1 225 N 1 59710513 T A unclassified Het probably benign phenotype 02/16/2017
31 438054 UTSW Olfr121 0.021 R5611 G1 225 N 17 37752084 I77F A T missense Het possibly damaging 0.942 phenotype 10/26/2016
32 438036 UTSW Otogl 0.394 R5611 G1 225 N 10 107786769 E1652G T C missense Het probably damaging 0.998 phenotype 10/26/2016
33 437998 UTSW Pikfyve 1.000 R5611 G1 225 N 1 65256088 N1459K C A missense Het probably damaging 0.959 phenotype 10/26/2016
34 438003 UTSW Pkn3 0.000 R5611 G1 225 N 2 30079661 G61D G A missense Het probably damaging 1.000 phenotype 10/26/2016
35 438027 UTSW Plekha4 0.139 R5611 G1 225 N 7 45553641 S581P T C missense Het probably benign 0.000 10/26/2016
36 438015 UTSW Ppm1g 1.000 R5611 G1 225 N 5 31206097 F256L A G missense Het probably damaging 0.999 phenotype 10/26/2016
37 438008 UTSW Proser1 0.000 R5611 G1 225 N 3 53478875 N726S A G missense Het probably benign 0.096 phenotype 10/26/2016
38 438002 UTSW Rapgef1 1.000 R5611 G1 175 N 2 29702436 D480G A G missense Het probably damaging 0.961 phenotype 10/26/2016
39 438014 UTSW Reln 0.944 R5611 G1 225 N 5 22039665 Q772* G A nonsense Het probably null phenotype 10/26/2016
40 438013 UTSW Sh3gl2 0.000 R5611 G1 225 N 4 85355331 V40A T C missense Het probably benign 0.394 phenotype 10/26/2016
41 438043 UTSW Slc22a23 0.349 R5611 G1 225 N 13 34305239 T221I G A missense Het probably benign 0.003 phenotype 10/26/2016
42 457997 UTSW Slc22a28 0.206 R5611 G1 225 N 19 8063333 T518S T A missense Het probably damaging 1.000 02/16/2017
43 457994 UTSW Slc4a1ap 0.297 R5611 G1 225 N 5 31553829 A G utr 3 prime Het probably benign 02/16/2017
44 438000 UTSW St8sia4 0.000 R5611 G1 225 N 1 95627684 D207G T C missense Het probably damaging 0.961 phenotype 10/26/2016
45 438035 UTSW Syde1 0.233 R5611 G1 225 N 10 78585891 T609S T A missense Het probably benign 0.000 phenotype 10/26/2016
46 438055 UTSW Tbc1d5 0.180 R5611 G1 225 N 17 50735967 I831T A G missense Het probably damaging 0.978 0.352 10/26/2016
47 438057 UTSW Tle4 0.780 R5611 G1 225 N 19 14449795 D754G T C missense Het probably damaging 0.996 phenotype 10/26/2016
48 438004 UTSW Ttn 1.000 R5611 G1 225 N 2 76732525 W26949* C T nonsense Het probably null phenotype 10/26/2016
49 438042 UTSW Vmn1r222 0.204 R5611 G1 225 N 13 23232573 S157A A C missense Het probably damaging 0.996 10/26/2016
50 438021 UTSW Vmn1r51 R5611 G1 225 N 6 90129710 L203M T A missense Het probably benign 0.044 phenotype 10/26/2016
51 438019 UTSW Vmn1r6 0.131 R5611 G1 225 N 6 57002377 L8P T C missense Het probably damaging 0.999 10/26/2016
52 438051 UTSW Vmn2r103 0.073 R5611 G1 225 N 17 19793642 D232G A G missense Het probably damaging 0.988 10/26/2016
53 457995 UTSW Vmn2r17 0.134 R5611 G1 225 N 5 109428164 D300E T A missense Het probably damaging 0.972 02/16/2017
54 438028 UTSW Vmn2r66 0.163 R5611 G1 225 N 7 85005743 K453* T A nonsense Het probably null 10/26/2016
55 438058 UTSW Vps13a 0.000 R5611 G1 225 N 19 16725572 D672E A T missense Het probably damaging 1.000 phenotype 10/26/2016
56 438037 UTSW Vps54 0.848 R5611 G1 225 N 11 21311130 N599S A G missense Het possibly damaging 0.655 phenotype 10/26/2016
57 438045 UTSW Zc3h13 0.965 R5611 G1 225 N 14 75330908 N1214Y A T missense Het probably benign 0.100 10/26/2016
58 438033 UTSW Zc3h18 0.829 R5611 G1 225 N 8 122408370 T G critical splice donor site 2 bp Het probably null 10/26/2016
59 438052 UTSW Zfp51 0.556 R5611 G1 225 N 17 21464092 E323G A G missense Het probably damaging 0.999 10/26/2016
[records 1 to 59 of 59]