Incidental Mutations

74 incidental mutations are currently displayed, and affect 74 genes.
12 are Possibly Damaging.
23 are Probably Damaging.
28 are Probably Benign.
9 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 74 of 74] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 501354 UTSW Adam8 0.000 R5696 G1 225 N 7 139989246 R186W G A missense Het probably benign 0.030 phenotype 12/01/2017
2 501356 UTSW Afg3l2 1.000 R5696 G1 225 N 18 67407459 I660T A G missense Het probably damaging 0.997 phenotype 12/01/2017
3 450654 UTSW Amtn 0.084 R5696 G1 225 N 5 88385085 Y186* T A nonsense Het probably null phenotype 01/03/2017
4 450681 UTSW Atrip 0.134 R5696 G1 225 N 9 109065501 S453P A G missense Het possibly damaging 0.593 phenotype 01/03/2017
5 450693 UTSW Bahcc1 0.662 R5696 G1 225 N 11 120273987 L840P T C missense Het probably damaging 1.000 phenotype 01/03/2017
6 450639 UTSW Capn2 1.000 R5696 G1 225 N 1 182478600 E527G T C missense Het possibly damaging 0.788 phenotype 01/03/2017
7 450663 UTSW Caprin2 0.511 R5696 G1 225 N 6 148877818 Y164N A T missense Het possibly damaging 0.486 phenotype 01/03/2017
8 450697 UTSW Ccnh 0.924 R5696 G1 225 N 13 85196327 T A critical splice donor site 2 bp Het probably null phenotype 01/03/2017
9 450677 UTSW Cdon 0.364 R5696 G1 225 N 9 35491866 V1091F G T missense Het possibly damaging 0.691 phenotype 01/03/2017
10 450666 UTSW Ceacam14 0.026 R5696 G1 225 N 7 17814342 Y119C A G missense Het probably damaging 0.972 01/03/2017
11 450674 UTSW Ces2h 0.170 R5696 G1 225 N 8 105018979 K445E A G missense Het possibly damaging 0.692 phenotype 01/03/2017
12 450671 UTSW Cfap46 0.060 R5696 G1 225 N 7 139612031 S2357P A G missense Het probably damaging 1.000 01/03/2017
13 450678 UTSW Commd4 0.208 R5696 G1 225 N 9 57156215 S86R A T missense Het possibly damaging 0.770 01/03/2017
14 450684 UTSW Cpsf6 0.947 R5696 G1 225 N 10 117361029 A T unclassified Het probably benign phenotype 01/03/2017
15 450680 UTSW Dag1 0.921 R5696 G1 225 N 9 108209447 V165E A T missense Het probably benign 0.085 phenotype 01/03/2017
16 450710 UTSW Dmxl1 0.863 R5696 G1 225 N 18 49931941 K2618* A T nonsense Het probably null phenotype 01/03/2017
17 450691 UTSW Dnah17 0.370 R5696 G1 225 N 11 118101056 Y1229H A G missense Het probably benign 0.443 phenotype 01/03/2017
18 450692 UTSW Endov 0.104 R5696 G1 225 N 11 119491799 L24Q T A missense Het probably damaging 1.000 01/03/2017
19 450679 UTSW Fam214a 0.258 R5696 G1 225 N 9 75010117 E666G A G missense Het probably benign 0.015 01/03/2017
20 450640 UTSW Fap 0.000 R5696 G1 225 N 2 62502459 V717M C T missense Het probably damaging 1.000 phenotype 01/03/2017
21 450682 UTSW Fbxl2 0.275 R5696 G1 225 N 9 113986478 L239P A G missense Het probably damaging 0.999 phenotype 01/03/2017
22 450652 UTSW Fbxl5 1.000 R5696 G1 225 N 5 43758840 V367D A T missense Het possibly damaging 0.934 phenotype 01/03/2017
23 450689 UTSW Fkbp10 1.000 R5696 G1 225 N 11 100423526 W384L G T missense Het probably damaging 1.000 phenotype 01/03/2017
24 450656 UTSW Gbp8 0.144 R5696 G1 225 N 5 105018816 V216I C T missense Het possibly damaging 0.923 01/03/2017
25 450649 UTSW Gclm 0.155 R5696 G1 225 N 3 122266287 A239T G A missense Het probably benign 0.107 phenotype 01/03/2017
26 450687 UTSW Gm11569 R5696 G1 175 N 11 99798730 C T unclassified Het probably benign 01/03/2017
27 450644 UTSW Gm14124 0.081 R5696 G1 225 N 2 150269474 H695Y C T missense Het possibly damaging 0.518 01/03/2017
28 450646 UTSW Gnas 1.000 R5696 G1 108 N 2 174299675 C A intron Het probably benign phenotype 01/03/2017
29 450685 UTSW Grb10 0.298 R5696 G1 225 N 11 11933566 N508I T A missense Het probably benign 0.234 phenotype 01/03/2017
30 450711 UTSW Gykl1 0.210 R5696 G1 225 N 18 52694195 I158M T G missense Het probably benign 0.018 phenotype 01/03/2017
31 450712 UTSW Ide 0.000 R5696 G1 102 N 19 37318021 T214M G A missense Het unknown phenotype 01/03/2017
32 450660 UTSW Il12rb2 0.000 R5696 G1 225 N 6 67295278 Q341H T A missense Het possibly damaging 0.936 phenotype 01/03/2017
33 450658 UTSW Ints1 1.000 R5696 G1 225 N 5 139754989 E1946G T C missense Het probably benign 0.002 phenotype 01/03/2017
34 450702 UTSW Kdelr3 0.274 R5696 G1 225 N 15 79525899 T C unclassified 1837 bp Het probably null phenotype 01/03/2017
35 450650 UTSW Kif1b 1.000 R5696 G1 225 N 4 149273849 A C splice site Het probably null phenotype 01/03/2017
36 450676 UTSW Kri1 0.886 R5696 G1 225 N 9 21280237 I320T A G missense Het probably damaging 0.999 phenotype 01/03/2017
37 450688 UTSW Krt9 0.000 R5696 G1 109 N 11 100189077 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC small deletion Het probably benign 0.156 phenotype 01/03/2017
38 450638 UTSW Lin9 1.000 R5696 G1 225 N 1 180659081 S111P T C missense Het probably benign 0.003 phenotype 01/03/2017
39 450657 UTSW Lpcat2b 0.335 R5696 G1 225 N 5 107432907 P34Q C A missense Het probably damaging 1.000 01/03/2017
40 450642 UTSW Ltk 0.286 R5696 G1 225 N 2 119759599 T49S T A missense Het probably benign 0.002 phenotype 01/03/2017
41 450695 UTSW Map3k9 0.000 R5696 G1 225 N 12 81734122 H421Q A T missense Het probably benign 0.002 phenotype 01/03/2017
42 450643 UTSW Mapkbp1 0.497 R5696 G1 225 N 2 120021720 T A splice site Het probably null 01/03/2017
43 450705 UTSW Mcm4 1.000 R5696 G1 225 N 16 15625570 S830P A G missense Het probably damaging 0.997 phenotype 01/03/2017
44 450698 UTSW Nek10 0.203 R5696 G1 225 N 14 14860736 T A splice site Het probably null 01/03/2017
45 450667 UTSW Nlrp9b 0.090 R5696 G1 225 N 7 20024492 R551S A T missense Het probably benign 0.019 phenotype 01/03/2017
46 450645 UTSW Nol4l 0.759 R5696 G1 225 N 2 153418106 T143A T C missense Het probably damaging 0.993 01/03/2017
47 450665 UTSW Olfr1346 0.053 R5696 G1 225 N 7 6474743 T C unclassified 3579 bp Het probably null phenotype 01/03/2017
48 450683 UTSW Olfr1355 0.094 R5696 G1 225 N 10 78880085 R304S A T missense Het probably benign 0.024 phenotype 01/03/2017
49 450686 UTSW Olfr398 0.207 R5696 G1 225 N 11 73984536 H24R T C missense Het possibly damaging 0.899 phenotype 01/03/2017
50 450670 UTSW Olfr578 0.264 R5696 G1 225 N 7 102984541 T208S T A missense Het probably benign 0.018 phenotype 01/03/2017
51 450648 UTSW Pde4dip 1.000 R5696 G1 225 N 3 97709490 A1812D G T missense Het probably damaging 0.999 phenotype 01/03/2017
52 450669 UTSW Plekhb1 0.000 R5696 G1 225 N 7 100656753 G26C C A missense Het probably damaging 1.000 phenotype 01/03/2017
53 450661 UTSW Polr1a 0.958 R5696 G1 225 N 6 71929426 F409I T A missense Het probably benign 0.052 phenotype 01/03/2017
54 450655 UTSW Ptpn13 0.320 R5696 G1 225 N 5 103554759 M1197K T A missense Het probably benign 0.198 phenotype 01/03/2017
55 450690 UTSW Qrich2 0.153 R5696 G1 225 N 11 116445002 I2114V T C missense Het probably damaging 0.996 01/03/2017
56 450709 UTSW Rbm27 0.220 R5696 G1 225 N 18 42317666 Y449H T C missense Het probably damaging 1.000 01/03/2017
57 450700 UTSW Rp1l1 0.165 R5696 G1 225 N 14 64029746 D927G A G missense Het probably damaging 0.991 phenotype 01/03/2017
58 450696 UTSW Secisbp2 0.153 R5696 G1 225 N 13 51679821 Q666K C A missense Het probably damaging 0.999 phenotype 01/03/2017
59 450701 UTSW Slc45a2 0.162 R5696 G1 225 N 15 11001133 I106T T C missense Het probably damaging 1.000 phenotype 01/03/2017
60 450704 UTSW Slx4 1.000 R5696 G1 225 N 16 3979967 Q1518K G T missense Het probably damaging 0.997 phenotype 01/03/2017
61 450662 UTSW Smim10l1 0.110 R5696 G1 225 N 6 133105526 F12S T C missense Het probably damaging 1.000 0.029 01/03/2017
62 450706 UTSW Son 0.950 R5696 G1 225 N 16 91671413 V306A T C missense Het possibly damaging 0.673 phenotype 01/03/2017
63 450699 UTSW Stab1 0.000 R5696 G1 225 N 14 31160221 S506P A G missense Het probably benign 0.000 phenotype 01/03/2017
64 450694 UTSW Syne2 0.317 R5696 G1 225 N 12 75994145 D3859A A C missense Het probably benign 0.002 phenotype 01/03/2017
65 450703 UTSW Tab1 1.000 R5696 G1 225 N 15 80148729 Y71* T A nonsense Het probably null phenotype 01/03/2017
66 450675 UTSW Tarbp1 0.586 R5696 G1 225 N 8 126447340 M909R A C missense Het probably damaging 0.983 phenotype 01/03/2017
67 450673 UTSW Tex15 0.515 R5696 G1 225 N 8 33573192 S1157R T G missense Het probably benign 0.011 phenotype 01/03/2017
68 450664 UTSW Tnni3 1.000 R5696 G1 225 N 7 4520454 T120I G A missense Het probably benign 0.026 phenotype 01/03/2017
69 450641 UTSW Ttn 1.000 R5696 G1 225 N 2 76917544 E4387G T C missense Het probably benign 0.000 phenotype 01/03/2017
70 501355 UTSW Ugt3a2 0.035 R5696 G1 225 N 15 9361448 G A splice site Het silent 12/01/2017
71 450672 UTSW Unc5d 0.309 R5696 G1 225 N 8 28666842 I783V T C missense Het probably benign 0.063 phenotype 01/03/2017
72 450636 UTSW Usp40 0.106 R5696 G1 225 N 1 87995752 T266A T C missense Het probably benign 0.269 phenotype 01/03/2017
73 450668 UTSW Vmn2r59 0.101 R5696 G1 225 N 7 42046044 V315I C T missense Het probably benign 0.003 01/03/2017
74 450651 UTSW Zbtb48 0.286 R5696 G1 225 N 4 152020610 H532N G T missense Het probably damaging 0.986 01/03/2017
[records 1 to 74 of 74]