Incidental Mutations

76 incidental mutations are currently displayed, and affect 76 genes.
16 are Possibly Damaging.
31 are Probably Damaging.
21 are Probably Benign.
8 are Probably Null.
5 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 451081 UTSW 4931423N10Rik 0.070 R5715 G1 225 N 2 23207977 Y56H T C missense Het possibly damaging 0.861 01/03/2017
2 451127 UTSW 9930111J21Rik2 0.356 R5715 G1 225 N 11 49019950 Y552F T A missense Het probably damaging 1.000 01/03/2017
3 451105 UTSW Asprv1 0.000 R5715 G1 225 N 6 86628614 D147E T A missense Het probably benign 0.000 phenotype 01/03/2017
4 451096 UTSW Atg4c 0.069 R5715 G1 225 N 4 99258402 L405F G T missense Het probably damaging 1.000 phenotype 01/03/2017
5 451146 UTSW Birc6 1.000 R5715 G1 225 N 17 74631620 L2670F C T missense Het probably damaging 0.999 phenotype 01/03/2017
6 451097 UTSW Cdc20 1.000 R5715 G1 225 N 4 118434818 D379G T C missense Het probably damaging 1.000 phenotype 01/03/2017
7 451090 UTSW Chd6 0.484 R5715 G1 225 N 2 160949878 M2520V T C missense Het probably benign 0.003 phenotype 01/03/2017
8 451093 UTSW Clca4b 0.103 R5715 G1 225 N 3 144913257 V707A A G missense Het probably benign 0.013 phenotype 01/03/2017
9 451115 UTSW Cmtm1 0.455 R5715 G1 167 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Het probably benign 01/03/2017
10 451121 UTSW Col12a1 0.351 R5715 G1 225 N 9 79616065 C2743* A T nonsense Het probably null phenotype 01/03/2017
11 451135 UTSW Coq6 0.884 R5715 G1 225 N 12 84366907 D70E C A missense Het probably benign 0.104 phenotype 01/03/2017
12 451119 UTSW Cspg4 0.000 R5715 G1 225 N 9 56891051 V1450D T A missense Het possibly damaging 0.896 phenotype 01/03/2017
13 451079 UTSW Dnah7a 0.285 R5715 G1 225 N 1 53413778 L3847P A G missense Het probably damaging 1.000 01/03/2017
14 451117 UTSW Drd2 0.233 R5715 G1 225 N 9 49404889 H316Q T A missense Het probably benign 0.003 phenotype 01/03/2017
15 451085 UTSW Dusp19 0.181 R5715 G1 225 N 2 80630986 N206K T A missense Het probably benign 0.430 phenotype 01/03/2017
16 451124 UTSW Fam13c 0.191 R5715 G1 225 N 10 70534840 F270C T G missense Het probably damaging 1.000 01/03/2017
17 451133 UTSW Fam20a 0.000 R5715 G1 225 N 11 109678431 E246G T C missense Het probably damaging 0.998 phenotype 01/03/2017
18 451116 UTSW Fbxo31 0.747 R5715 G1 118 N 8 121578563 F65L A G missense Het probably damaging 0.998 phenotype 01/03/2017
19 451147 UTSW Fshr 0.000 R5715 G1 225 N 17 88986396 T A critical splice acceptor site Het probably null phenotype 01/03/2017
20 451128 UTSW Fstl4 0.271 R5715 G1 225 N 11 53000416 V127A T C missense Het possibly damaging 0.527 phenotype 01/03/2017
21 451109 UTSW Gdpd4 0.073 R5715 G1 225 N 7 97961597 I75F A T missense Het probably benign 0.002 01/03/2017
22 451100 UTSW Gm13128 0.049 R5715 G1 225 N 4 144331300 D159G A G missense Het possibly damaging 0.670 01/03/2017
23 451108 UTSW Grm5 0.290 R5715 G1 181 N 7 88130256 A968E C A missense Het probably benign 0.054 phenotype 01/03/2017
24 451153 UTSW Gucy2g 0.000 R5715 G1 225 N 19 55233155 F305V A C missense Het possibly damaging 0.928 phenotype 01/03/2017
25 451098 UTSW Hivep3 0.000 R5715 G1 225 N 4 120096373 F629L T C missense Het probably benign 0.000 phenotype 01/03/2017
26 451131 UTSW Hoxb1 1.000 R5715 G1 225 N 11 96366326 E167G A G missense Het probably benign 0.005 phenotype 01/03/2017
27 451084 UTSW Hoxd4 0.399 R5715 G1 225 N 2 74727364 L29P T C missense Het probably damaging 1.000 phenotype 01/03/2017
28 451113 UTSW Ikbkb 1.000 R5715 G1 225 N 8 22678850 L211P A G missense Het probably damaging 1.000 phenotype 01/03/2017
29 451112 UTSW Insc 0.510 R5715 G1 225 N 7 114849841 V499A T C missense Het probably benign 0.039 phenotype 01/03/2017
30 451125 UTSW Irak3 0.382 R5715 G1 225 N 10 120142736 H511Q A T missense Het possibly damaging 0.662 phenotype 01/03/2017
31 451088 UTSW Itpripl1 0.142 R5715 G1 225 N 2 127142007 E65G T C missense Het probably damaging 0.976 01/03/2017
32 451095 UTSW Lurap1l 0.073 R5715 G1 225 N 4 80953721 S150R T A missense Het possibly damaging 0.928 01/03/2017
33 451091 UTSW Mab21l3 0.085 R5715 G1 211 N 3 101823407 R172Q C T missense Het probably benign 0.356 01/03/2017
34 451099 UTSW Macf1 1.000 R5715 G1 225 N 4 123684014 D59G T C missense Het probably damaging 0.995 phenotype 01/03/2017
35 451080 UTSW Mettl21a 0.049 R5715 G1 225 N 1 64615155 S68T A T missense Het probably benign 0.001 01/03/2017
36 451102 UTSW Mlxip 0.286 R5715 G1 193 N 5 123440058 W146R T A missense Het probably damaging 1.000 phenotype 01/03/2017
37 451132 UTSW Mpp2 0.445 R5715 G1 225 N 11 102062261 N285I T A missense Het probably damaging 0.999 phenotype 01/03/2017
38 451107 UTSW Mrgprb4 0.000 R5715 G1 225 N 7 48199039 N47S T C missense Het probably damaging 1.000 phenotype 01/03/2017
39 451130 UTSW Msi2 1.000 R5715 G1 225 N 11 88386063 Y237H A G missense Het probably damaging 0.998 phenotype 01/03/2017
40 451141 UTSW Muc4 0.177 R5715 G1 225 N 16 32751916 T598I C T missense Het possibly damaging 0.921 phenotype 01/03/2017
41 451094 UTSW Musk 1.000 R5715 G1 225 N 4 58333663 I253F A T missense Het probably damaging 1.000 phenotype 01/03/2017
42 451148 UTSW Myo5b 0.494 R5715 G1 225 N 18 74742175 C1550F G T missense Het possibly damaging 0.881 phenotype 01/03/2017
43 451140 UTSW Nckap5l 0.313 R5715 G1 183 N 15 99423576 T1137A T C missense Het probably benign 0.006 01/03/2017
44 451082 UTSW Neb 0.581 R5715 G1 225 N 2 52251768 D3009G T C missense Het probably damaging 0.998 phenotype 01/03/2017
45 451103 UTSW Nxph1 0.400 R5715 G1 225 N 6 9247740 V237E T A missense Het probably damaging 1.000 phenotype 01/03/2017
46 451111 UTSW Olfr622 0.050 R5715 G1 225 N 7 103639802 S113A A C missense Het probably damaging 0.999 phenotype 01/03/2017
47 451092 UTSW Pla2g12a 0.044 R5715 G1 206 N 3 129894942 K150E A G missense Het probably damaging 0.999 phenotype 01/03/2017
48 451123 UTSW Ptpn23 1.000 R5715 G1 225 N 9 110387075 R1238W G A missense Het probably damaging 0.999 phenotype 01/03/2017
49 451118 UTSW Pts R5715 G1 225 N 9 50522278 G124R C T missense Het probably damaging 0.987 phenotype 01/03/2017
50 451151 UTSW Rfk 1.000 R5715 G1 225 N 19 17398638 I99F A T missense Het probably benign 0.001 phenotype 01/03/2017
51 451137 UTSW Rictor 1.000 R5715 G1 224 N 15 6750716 R151* A T nonsense Het probably null phenotype 01/03/2017
52 451083 UTSW Scn2a 1.000 R5715 G1 225 N 2 65717584 I1040N T A missense Het probably benign 0.274 phenotype 01/03/2017
53 451136 UTSW Serinc5 0.117 R5715 G1 225 N 13 92706202 T387P A C missense Het probably damaging 1.000 01/03/2017
54 451129 UTSW Sh3bp5l 0.132 R5715 G1 225 N 11 58346015 Q266R A G missense Het possibly damaging 0.812 01/03/2017
55 451149 UTSW Slc14a2 0.000 R5715 G1 225 N 18 78158336 Y656C T C missense Het probably damaging 1.000 phenotype 01/03/2017
56 451134 UTSW Slc26a3 0.246 R5715 G1 225 N 12 31448843 T A critical splice donor site 2 bp Het probably null phenotype 01/03/2017
57 451150 UTSW Slc3a2 1.000 R5715 G1 186 N 19 8708230 H168Q G T missense Het probably benign 0.000 phenotype 01/03/2017
58 451152 UTSW Smarca2 0.000 R5715 G1 225 N 19 26649122 I449L A T missense Het probably benign 0.163 phenotype 01/03/2017
59 451122 UTSW Smarcc1 1.000 R5715 G1 225 N 9 110196367 V704A T C missense Het possibly damaging 0.954 phenotype 01/03/2017
60 501372 UTSW Sox13 0.000 R5715 G1 225 N 1 133386183 A G critical splice donor site 2 bp Het probably null phenotype 12/01/2017
61 451086 UTSW Sptbn5 0.217 R5715 G1 225 N 2 120072504 E7G T C missense Het probably damaging 1.000 01/03/2017
62 451110 UTSW Stard10 0.277 R5715 G1 225 N 7 101321903 D26G A G missense Het probably damaging 1.000 phenotype 01/03/2017
63 451144 UTSW Tap1 0.000 R5715 G1 225 N 17 34192894 R91* A T nonsense Het probably null phenotype 01/03/2017
64 451078 UTSW Tgfbrap1 1.000 R5715 G1 225 N 1 43059937 V239D A T missense Het possibly damaging 0.639 phenotype 01/03/2017
65 451104 UTSW Tmem209 0.527 R5715 G1 225 N 6 30497923 Y124* A T nonsense Het probably null 01/03/2017
66 451142 UTSW Tmprss2 0.000 R5715 G1 225 N 16 97568983 E327V T A missense Het possibly damaging 0.650 phenotype 01/03/2017
67 451145 UTSW Ttbk1 0.230 R5715 G1 225 N 17 46479207 Y104C T C missense Het probably damaging 0.992 phenotype 01/03/2017
68 451101 UTSW Ttll10 0.193 R5715 G1 225 N 4 156045391 F154I A T missense Het probably damaging 0.997 01/03/2017
69 501373 UTSW Ubn2 0.656 R5715 G1 225 N 6 38461477 Y40* T A nonsense Het probably null 12/01/2017
70 451139 UTSW Ubr5 1.000 R5715 G1 225 N 15 38002233 S1519T A T missense Het probably benign 0.065 phenotype 01/03/2017
71 451138 UTSW Ugt3a1 0.146 R5715 G1 170 N 15 9306344 D193A A C missense Het probably damaging 0.959 01/03/2017
72 451114 UTSW Upf1 0.973 R5715 G1 190 N 8 70352978 Y6N A T missense Het probably damaging 0.961 phenotype 01/03/2017
73 451143 UTSW Vmn2r103 0.087 R5715 G1 225 N 17 19794939 D447V A T missense Het probably benign 0.175 01/03/2017
74 451087 UTSW Vps39 0.718 R5715 G1 225 N 2 120325236 N519S T C missense Het possibly damaging 0.728 phenotype 01/03/2017
75 451106 UTSW Zfp109 0.092 R5715 G1 225 N 7 24229570 E138G T C missense Het possibly damaging 0.917 01/03/2017
76 451126 UTSW Znrf3 1.000 R5715 G1 225 N 11 5286239 V157G A C missense Het possibly damaging 0.913 phenotype 01/03/2017
[records 1 to 76 of 76]