Incidental Mutations

75 incidental mutations are currently displayed, and affect 75 genes.
9 are Possibly Damaging.
30 are Probably Damaging.
26 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 75 of 75] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 480055 UTSW 1810065E05Rik 0.217 R6026 G1 225.01 Y 11 58425755 D187G A G missense Het probably benign 0.060 0.128 06/26/2017
2 480041 UTSW 4933421I07Rik 0.046 R6026 G1 225.01 Y 7 42446284 M180K A T missense Het probably benign 0.061 0.105 06/26/2017
3 502061 UTSW Aatk 0.317 R6026 G1 20.05 Y 11 120012364 H345R T C missense Het possibly damaging 0.654 0.202 phenotype 02/26/2018
4 480042 UTSW Abcc8 0.570 R6026 G1 225.01 Y 7 46167000 T239A T C missense Het probably benign 0.000 0.070 phenotype 06/26/2017
5 480073 UTSW Abcf3 0.387 R6026 G1 201.01 Y 16 20550570 E234G A G missense Het probably damaging 1.000 0.420 06/26/2017
6 480026 UTSW Actrt2 0.145 R6026 G1 137.01 Y 4 154666590 D363G T C missense Het possibly damaging 0.828 0.218 phenotype 06/26/2017
7 480031 UTSW Adam1a 0.079 R6026 G1 225.01 Y 5 121519362 C623S A T missense Het probably damaging 1.000 0.024 phenotype 06/26/2017
8 480079 UTSW Afg3l2 1.000 R6026 G1 225.01 Y 18 67421259 L458M G T missense Het probably damaging 1.000 0.298 phenotype 06/26/2017
9 480021 UTSW Ash1l 0.408 R6026 G1 225.01 Y 3 88985019 Y1402H T C missense Het probably damaging 0.998 0.222 phenotype 06/26/2017
10 480030 UTSW Barhl2 1.000 R6026 G1 225.01 Y 5 106455608 K228N T A missense Het probably benign 0.035 0.127 phenotype 06/26/2017
11 480040 UTSW Blvrb 0.140 R6026 G1 120.01 Y 7 27462690 H153R A G missense Het probably damaging 0.999 0.390 phenotype 06/26/2017
12 480046 UTSW Capn9 0.190 R6026 G1 225.01 Y 8 124605862 D480G A G missense Het probably damaging 0.995 0.358 phenotype 06/26/2017
13 480020 UTSW Cct3 1.000 R6026 G1 225.01 Y 3 88311722 I182T T C missense Het possibly damaging 0.899 0.182 phenotype 06/26/2017
14 480051 UTSW Clasp2 0.000 R6026 G1 225.01 Y 9 113911578 N1208D A G missense Het probably benign 0.130 0.116 phenotype 06/26/2017
15 480033 UTSW Col26a1 0.585 R6026 G1 121.01 Y 5 136847500 C89R A G missense Het probably damaging 0.999 0.620 phenotype 06/26/2017
16 480029 UTSW Cops4 0.868 R6026 G1 207.01 Y 5 100542328 T A unclassified Het probably benign 0.066 phenotype 06/26/2017
17 480074 UTSW Cpox 0.676 R6026 G1 225.01 Y 16 58670935 W170R T A missense Het probably damaging 1.000 0.660 phenotype 06/26/2017
18 480016 UTSW Ddx27 0.941 R6026 G1 225.01 Y 2 167033640 K656E A G missense Het probably benign 0.004 0.180 phenotype 06/26/2017
19 480023 UTSW Eif4e 0.858 R6026 G1 225.01 Y 3 138550900 I66T T C missense Het probably damaging 0.996 0.382 phenotype 06/26/2017
20 480078 UTSW Ercc3 1.000 R6026 G1 225.01 Y 18 32245921 T C critical splice donor site 2 bp Het probably null 0.458 phenotype 06/26/2017
21 480076 UTSW Esp38 0.043 R6026 G1 225.01 Y 17 39955141 C47Y G A missense Het probably damaging 0.989 0.088 06/26/2017
22 480037 UTSW Fancd2 1.000 R6026 G1 208.01 Y 6 113551770 V380A T C missense Het possibly damaging 0.456 0.071 phenotype 06/26/2017
23 480017 UTSW Fbxw7 1.000 R6026 G1 218.01 Y 3 84952641 T A critical splice donor site 2 bp Het probably null 0.442 phenotype 06/26/2017
24 480027 UTSW Fryl 0.876 R6026 G1 225.01 Y 5 73099997 R736S T G missense Het probably benign 0.038 0.103 phenotype 06/26/2017
25 480015 UTSW Gad2 0.000 R6026 G1 95.01 Y 2 22623736 V62M G A missense Het probably benign 0.003 0.064 phenotype 06/26/2017
26 480011 UTSW Gigyf2 0.750 R6026 G1 225.01 Y 1 87440732 T1045A A G missense Het probably damaging 0.991 0.068 phenotype 06/26/2017
27 480025 UTSW Gm13090 0.054 R6026 G1 225.01 Y 4 151090700 L78* T A nonsense Het probably null 0.618 06/26/2017
28 480044 UTSW Gm19410 0.134 R6026 G1 225.01 Y 8 35812426 S1815N G A missense Het probably benign 0.030 06/26/2017
29 480065 UTSW Gm28051 0.067 R6026 G1 113.01 Y 12 102720185 L72Q A T missense Het unknown 0.062 06/26/2017
30 480038 UTSW Gm44511 0.142 R6026 G1 225.01 Y 6 128820277 T83A T C missense Het possibly damaging 0.890 0.056 06/26/2017
31 480082 UTSW Grk2 1.000 R6026 G1 215.01 Y 19 4290783 V246I C T missense Het probably damaging 0.994 0.290 phenotype 06/26/2017
32 480036 UTSW Grm7 0.000 R6026 G1 225.01 Y 6 111501539 Q62* C T nonsense Het probably null 0.456 phenotype 06/26/2017
33 480070 UTSW Gsdmc3 0.028 R6026 G1 225.01 Y 15 63866751 E154V T A missense Het probably damaging 1.000 0.130 06/26/2017
34 480064 UTSW Gstz1 0.000 R6026 G1 225.01 Y 12 87160174 Q114P A C missense Het probably damaging 0.994 0.336 phenotype 06/26/2017
35 480022 UTSW Hax1 0.288 R6026 G1 217.47 Y 3 89997940 GTCATCATCATCATCATC GTCATCATCATCATCATCATC small insertion Het probably benign 0.071 phenotype 06/26/2017
36 480045 UTSW Hhip 1.000 R6026 G1 225.01 Y 8 79972440 C666S A T missense Het probably damaging 1.000 0.314 phenotype 06/26/2017
37 480063 UTSW Hif1a 1.000 R6026 G1 225.01 Y 12 73932281 H193P A C missense Het probably damaging 0.999 0.440 phenotype 06/26/2017
38 480049 UTSW Hyal2 1.000 R6026 G1 225.01 Y 9 107572199 T385A A G missense Het probably benign 0.001 0.028 phenotype 06/26/2017
39 480010 UTSW Ihh 1.000 R6026 G1 225.01 Y 1 74946727 T200A T C missense Het probably benign 0.079 0.064 phenotype 06/26/2017
40 480019 UTSW Iqgap3 0.398 R6026 G1 225.01 Y 3 88090171 V218E T A missense Het probably damaging 1.000 0.238 06/26/2017
41 480012 UTSW Lct 0.352 R6026 G1 225.01 Y 1 128300018 I1246T A G missense Het probably benign 0.000 0.118 phenotype 06/26/2017
42 480069 UTSW Lmo7 0.209 R6026 G1 225.01 Y 14 101880990 V217A T C missense Het probably benign 0.035 0.124 phenotype 06/26/2017
43 480053 UTSW Lrp1 1.000 R6026 G1 225.01 Y 10 127573403 D1616N C T missense Het probably damaging 0.998 0.148 phenotype 06/26/2017
44 480050 UTSW Lrrfip2 0.500 R6026 G1 225.01 Y 9 111214171 T165S A T missense Het probably damaging 0.998 0.334 06/26/2017
45 480075 UTSW Morc2b 0.157 R6026 G1 225.01 Y 17 33137983 Y272H A G missense Het possibly damaging 0.547 0.338 phenotype 06/26/2017
46 480047 UTSW Muc16 0.214 R6026 G1 225.01 Y 9 18659858 M455T A G missense Het unknown 0.057 phenotype 06/26/2017
47 480066 UTSW Ncapg2 1.000 R6026 G1 225.01 Y 12 116443021 D939V A T missense Het possibly damaging 0.730 0.162 phenotype 06/26/2017
48 480057 UTSW Ncbp3 0.213 R6026 G1 225.01 Y 11 73067722 V236A T C missense Het probably benign 0.003 0.132 06/26/2017
49 480056 UTSW Obscn 0.693 R6026 G1 225.01 Y 11 59067090 T3595S T A missense Het probably damaging 0.982 0.076 phenotype 06/26/2017
50 480024 UTSW Odf2l 0.101 R6026 G1 225.01 Y 3 145149036 S545P T C missense Het possibly damaging 0.931 0.087 06/26/2017
51 480058 UTSW Olfr410 0.212 R6026 G1 225.01 Y 11 74335088 I48F T A missense Het probably damaging 0.993 0.354 phenotype 06/26/2017
52 480048 UTSW Olfr883 0.086 R6026 G1 217.47 Y 9 38026540 ATTGCTGTTT ATTGCTGTTTGCTGTTT frame shift Het probably null 0.627 phenotype 06/26/2017
53 480035 UTSW Pdzrn3 0.599 R6026 G1 225.01 Y 6 101362144 C269G A C missense Het probably benign 0.404 0.062 phenotype 06/26/2017
54 480018 UTSW Pear1 0.098 R6026 G1 225.01 Y 3 87756913 N278Y T A missense Het probably damaging 1.000 0.404 phenotype 06/26/2017
55 480059 UTSW Phb 1.000 R6026 G1 225.01 Y 11 95671419 R41* C T nonsense Het probably null 0.656 phenotype 06/26/2017
56 480009 UTSW Pikfyve 1.000 R6026 G1 225.01 Y 1 65272697 V2031A T C missense Het probably damaging 0.999 0.404 phenotype 06/26/2017
57 480014 UTSW Plxna2 0.000 R6026 G1 225.01 Y 1 194799814 I1465V A G missense Het probably damaging 0.999 0.284 phenotype 06/26/2017
58 480071 UTSW Ppp6r2 0.213 R6026 G1 225.01 Y 15 89282910 N776S A G missense Het probably benign 0.022 0.026 phenotype 06/26/2017
59 480077 UTSW Prkce 0.000 R6026 G1 225.01 Y 17 86493230 E358V A T missense Het probably benign 0.020 0.070 phenotype 06/26/2017
60 480067 UTSW Prl5a1 0.047 R6026 G1 225.01 Y 13 28151264 I219F A T missense Het probably benign 0.428 0.119 06/26/2017
61 482090 UTSW Prss3 0.147 R6026 G1 225.01 Y 6 41377554 T C splice site 4 bp Het probably null 0.636 06/27/2017
62 480013 UTSW Ptprc 0.265 R6026 G1 225.01 Y 1 138071249 M858K A T missense Het probably damaging 0.984 0.384 phenotype 06/26/2017
63 480062 UTSW Retreg3 0.225 R6026 G1 225.01 Y 11 101106400 T85A T C missense Het probably damaging 0.994 0.298 06/26/2017
64 480032 UTSW Rfc2 0.932 R6026 G1 225.01 Y 5 134595331 C265S T A missense Het probably damaging 0.987 0.496 phenotype 06/26/2017
65 480072 UTSW Smarcd1 0.875 R6026 G1 225.01 Y 15 99705738 V256L G T missense Het probably damaging 1.000 0.480 phenotype 06/26/2017
66 480061 UTSW Stat5a 0.000 R6026 G1 225.01 N 11 100880316 F574L T C missense Het probably damaging 1.000 phenotype 06/26/2017
67 480081 UTSW Tcirg1 0.496 R6026 G1 225.01 Y 19 3897487 H624R T C missense Het probably benign 0.000 0.127 phenotype 06/26/2017
68 480068 UTSW Tcstv1 0.080 R6026 G1 109.01 N 13 119894451 C A intron Het probably benign 06/26/2017
69 480054 UTSW Tenm2 0.000 R6026 G1 225.01 Y 11 36072729 C T critical splice donor site 1 bp Het probably null 0.546 phenotype 06/26/2017
70 480039 UTSW Tomm40 0.938 R6026 G1 225.01 Y 7 19710964 V164A A G missense Het probably benign 0.430 0.094 phenotype 06/26/2017
71 480080 UTSW Txnl4a 0.946 R6026 G1 225.01 Y 18 80207267 V26A T C missense Het probably damaging 0.978 0.420 phenotype 06/26/2017
72 480028 UTSW Ugt2a3 0.057 R6026 G1 225.01 N 5 87336477 F229L A T missense Het probably benign 0.003 06/26/2017
73 480052 UTSW Utp20 0.979 R6026 G1 225.01 Y 10 88768679 T1785A T C missense Het probably benign 0.035 0.068 phenotype 06/26/2017
74 480034 UTSW Vmn1r22 0.098 R6026 G1 225.01 Y 6 57900405 I196L T A missense Het probably benign 0.002 0.167 06/26/2017
75 480060 UTSW Zfp652 0.439 R6026 G1 225.01 Y 11 95749962 C238G T G missense Het possibly damaging 0.948 0.040 06/26/2017
[records 1 to 75 of 75]