Incidental Mutations

57 incidental mutations are currently displayed, and affect 57 genes.
10 are Possibly Damaging.
23 are Probably Damaging.
15 are Probably Benign.
8 are Probably Null.
0 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 57 of 57] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 486420 UTSW Arhgef4 0.238 R6034 G1 225.01 Y 1 34721903 G80V G T missense Het unknown 0.050 phenotype 08/16/2017
2 486429 UTSW Ash1l 0.419 R6034 G1 225.01 Y 3 88985019 Y1402H T C missense Het probably damaging 0.998 0.222 phenotype 08/16/2017
3 486463 UTSW Atad2 0.348 R6034 G1 225.01 Y 15 58108563 L306Q A T missense Het probably damaging 1.000 0.027 phenotype 08/16/2017
4 486423 UTSW Atp2b4 0.309 R6034 G1 225.01 Y 1 133731907 T A critical splice acceptor site Het probably null 0.518 phenotype 08/16/2017
5 486456 UTSW Atp6v1c2 0.240 R6034 G1 225.01 Y 12 17307500 G95V C A missense Het possibly damaging 0.788 0.062 phenotype 08/16/2017
6 486468 UTSW Birc6 1.000 R6034 G1 225.01 Y 17 74615283 V2192E T A missense Het probably damaging 0.999 0.332 phenotype 08/16/2017
7 486458 UTSW Catsperb 0.096 R6034 G1 225.01 Y 12 101575832 E597G A G missense Het probably benign 0.000 0.057 08/16/2017
8 486437 UTSW Ccdc129 0.023 R6034 G1 225.01 Y 6 55967681 D462E T A missense Het possibly damaging 0.936 0.026 08/16/2017
9 486455 UTSW Ccdc40 0.268 R6034 G1 191.01 Y 11 119243072 M556V A G missense Het possibly damaging 0.702 0.206 phenotype 08/16/2017
10 486431 UTSW Ccin 0.396 R6034 G1 225.01 Y 4 43985354 R587K G A missense Het probably benign 0.003 0.056 phenotype 08/16/2017
11 486443 UTSW Cdipt 0.857 R6034 G1 225.01 Y 7 126978325 V81G T G missense Het probably damaging 0.988 0.220 phenotype 08/16/2017
12 486424 UTSW Cfh 0.108 R6034 G1 225.01 Y 1 140163131 K40E T C missense Het probably damaging 0.981 0.027 phenotype 08/16/2017
13 486462 UTSW Col4a3bp 1.000 R6034 G1 225.01 Y 13 96609800 I236L A C missense Het probably benign 0.062 0.094 phenotype 08/16/2017
14 486422 UTSW Cps1 1.000 R6034 G1 225.01 Y 1 67157713 T A intron Het probably null 0.624 phenotype 08/16/2017
15 486421 UTSW Dnah7c 0.435 R6034 G1 225.01 Y 1 46457258 D101V A T missense Het probably benign 0.001 0.136 08/16/2017
16 486461 UTSW Fastkd3 0.145 R6034 G1 225.01 Y 13 68583610 W17R T A missense Het probably damaging 0.988 0.130 phenotype 08/16/2017
17 502009 UTSW Gapdh 1.000 R6034 G1 56.01 Y 6 125165298 D25G T C missense Het probably benign 0.246 0.118 phenotype 02/15/2018
18 486466 UTSW H2-Ob 0.100 R6034 G1 225.01 Y 17 34241218 V30A T C missense Het probably damaging 1.000 0.062 phenotype 08/16/2017
19 486460 UTSW Hist1h1e 0.000 R6034 G1 165.01 Y 13 23622313 L62P A G missense Het probably damaging 0.999 0.536 phenotype 08/16/2017
20 486472 UTSW Hmgxb3 0.603 R6034 G1 225.01 Y 18 61132522 H1128L T A missense Het probably damaging 1.000 0.446 phenotype 08/16/2017
21 486439 UTSW Hspbp1 0.160 R6034 G1 225.01 Y 7 4677712 I255N A T missense Het probably damaging 1.000 0.298 phenotype 08/16/2017
22 486419 UTSW Imp4 0.845 R6034 G1 225.01 Y 1 34443456 D91G A G missense Het probably damaging 0.998 0.338 phenotype 08/16/2017
23 486433 UTSW Kcnip4 0.120 R6034 G1 225.01 Y 5 48390941 R241S G T missense Het possibly damaging 0.887 0.048 phenotype 08/16/2017
24 486438 UTSW Lilra5 0.024 R6034 G1 225.01 Y 7 4242134 L259P T C missense Het probably benign 0.334 0.338 phenotype 08/16/2017
25 486474 UTSW Lipf 0.212 R6034 G1 225.01 Y 19 33964889 I73T T C missense Het probably benign 0.000 0.121 phenotype 08/16/2017
26 486450 UTSW Lsm7 0.929 R6034 G1 225.01 N 10 80852908 T C utr 3 prime Het probably null phenotype 08/16/2017
27 486441 UTSW Luzp2 0.000 R6034 G1 225.01 Y 7 55167224 L141M T A missense Het probably damaging 1.000 0.178 phenotype 08/16/2017
28 486426 UTSW Malrd1 0.244 R6034 G1 225.01 Y 2 15845326 V1252E T A missense Het possibly damaging 0.784 0.284 08/16/2017
29 486445 UTSW Map10 0.086 R6034 G1 225.01 Y 8 125672466 L866P T C missense Het probably damaging 1.000 0.028 08/16/2017
30 501776 UTSW Mink1 0.705 R6034 G1 123.47 N 11 70607040 AAGCAGCAGCAGCAGCAGCAGCAG AAGCAGCAGCAGCAGCAGCAG small deletion Het probably benign phenotype 12/01/2017
31 486454 UTSW Mpp2 0.396 R6034 G1 225.01 Y 11 102061634 I355V T C missense Het possibly damaging 0.880 0.158 phenotype 08/16/2017
32 501775 UTSW Mtrf1l 0.832 R6034 G1 105.01 N 10 5823834 T A unclassified Het probably benign phenotype 12/01/2017
33 486447 UTSW Myo5c 0.146 R6034 G1 225.01 Y 9 75255905 T339S A T missense Het probably benign 0.047 0.012 08/16/2017
34 486428 UTSW Naa15 0.980 R6034 G1 225.01 Y 3 51442821 D163G A G missense Het probably damaging 0.975 0.438 phenotype 08/16/2017
35 486452 UTSW Olfr1 0.147 R6034 G1 217.47 Y 11 73395654 AGCGGTCGTAGGC AGC frame shift Het probably null 0.638 phenotype 08/16/2017
36 486427 UTSW Olfr1303 0.115 R6034 G1 225.01 Y 2 111814357 Y123F T A missense Het probably damaging 1.000 0.018 phenotype 08/16/2017
37 486473 UTSW Oosp2 0.047 R6034 G1 225.01 Y 19 11651515 F74S A G missense Het probably damaging 1.000 0.398 08/16/2017
38 501774 UTSW Pard3 1.000 R6034 G1 93.01 N 8 127064327 C G utr 5 prime Het probably benign phenotype 12/01/2017
39 486470 UTSW Pcdha1 0.000 R6034 G1 225.01 N 18 36930598 I105N T A missense Het probably damaging 1.000 0.294 phenotype 08/16/2017
40 486471 UTSW Pcdhgb8 0.242 R6034 G1 225.01 Y 18 37762548 T224A A G missense Het possibly damaging 0.535 0.053 08/16/2017
41 486453 UTSW Phf12 0.361 R6034 G1 225.01 Y 11 78018069 N325S A G missense Het probably benign 0.081 0.312 08/16/2017
42 486432 UTSW Prom1 0.455 R6034 G1 225.01 Y 5 44044408 T A critical splice acceptor site Het probably null 0.496 phenotype 08/16/2017
43 486449 UTSW Raet1e 0.420 R6034 G1 225.01 Y 10 22182091 *252W A G makesense Het probably null 0.619 08/16/2017
44 486469 UTSW Sap130 0.842 R6034 G1 225.01 Y 18 31689406 V655A T C missense Het possibly damaging 0.922 0.358 phenotype 08/16/2017
45 486425 UTSW Sec16b 0.123 R6034 G1 225.01 Y 1 157552939 K360I A T missense Het probably damaging 1.000 0.055 phenotype 08/16/2017
46 486444 UTSW Sec23ip 0.512 R6034 G1 225.01 Y 7 128750203 T101I C T missense Het possibly damaging 0.660 0.144 phenotype 08/16/2017
47 486464 UTSW Selenoo 0.108 R6034 G1 225.01 Y 15 89099343 K529R A G missense Het probably benign 0.003 0.106 phenotype 08/16/2017
48 486430 UTSW Slc22a15 0.027 R6034 G1 225.01 Y 3 101862919 F451L A G missense Het possibly damaging 0.804 0.278 phenotype 08/16/2017
49 486467 UTSW St6gal2 0.143 R6034 G1 225.01 Y 17 55482981 S339T T A missense Het probably benign 0.000 0.129 phenotype 08/16/2017
50 486435 UTSW Stard13 0.000 R6034 G1 225.01 Y 5 151095500 A T splice site Het probably null 0.628 phenotype 08/16/2017
51 486442 UTSW Synm 0.259 R6034 G1 225.01 Y 7 67734905 V561A A G missense Het probably damaging 1.000 0.126 phenotype 08/16/2017
52 486459 UTSW Tc2n 0.061 R6034 G1 225.01 Y 12 101651201 A T splice site Het probably null 0.608 08/16/2017
53 486434 UTSW Ugt2b36 0.100 R6034 G1 225.01 Y 5 87081518 D236V T A missense Het probably damaging 1.000 0.606 08/16/2017
54 486440 UTSW Vmn1r65 0.050 R6034 G1 225.01 Y 7 6008869 L122P A G missense Het probably damaging 1.000 0.344 08/16/2017
55 486457 UTSW Zc3h14 0.258 R6034 G1 225.01 Y 12 98771373 S40P T C missense Het probably benign 0.006 0.122 phenotype 08/16/2017
56 486436 UTSW Zc3hav1l 0.151 R6034 G1 225.01 Y 6 38295280 G185C C A missense Het probably damaging 1.000 0.148 08/16/2017
57 486465 UTSW Zfp563 0.065 R6034 G1 225.01 Y 17 33104961 A177T G A missense Het probably damaging 0.957 0.154 08/16/2017
[records 1 to 57 of 57]