Incidental Mutations

82 incidental mutations are currently displayed, and affect 81 genes.
10 are Possibly Damaging.
31 are Probably Damaging.
30 are Probably Benign.
10 are Probably Null.
2 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 82 of 82] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 486501 UTSW A2m 0.000 R6035 G1 225.01 Y 6 121638394 G76W G T missense Het probably damaging 0.994 0.021 phenotype 08/16/2017
2 486548 UTSW Abca17 0.296 R6035 G1 225.01 Y 17 24281245 F1324Y A T missense Het possibly damaging 0.791 08/16/2017
3 486526 UTSW Abca8b 0.252 R6035 G1 225.01 Y 11 109971860 A T splice site Het probably null phenotype 08/16/2017
4 486512 UTSW Abcc12 0.085 R6035 G1 225.01 Y 8 86517404 M1040T A G missense Het probably damaging 0.975 0.060 phenotype 08/16/2017
5 486497 UTSW Abtb1 0.348 R6035 G1 163.01 N 6 88841806 F7L A G missense Het probably damaging 0.997 0.240 phenotype 08/16/2017
6 486544 UTSW Adcy9 0.576 R6035 G1 225.01 N 16 4304513 T558A T C missense Het probably benign 0.000 0.100 phenotype 08/16/2017
7 501746 UTSW Adgrb1 0.000 R6035 G1 147.01 N 15 74540443 T424S A T missense Het possibly damaging 0.496 0.152 phenotype 12/01/2017
8 486553 UTSW Afg3l2 1.000 R6035 G1 225.01 Y 18 67421259 L458M G T missense Het probably damaging 1.000 0.298 phenotype 08/16/2017
9 486535 UTSW Ankrd31 0.325 R6035 G1 225.01 Y 13 96832213 P786Q C A missense Het probably benign 0.004 08/16/2017
10 486543 UTSW Arhgap39 0.187 R6035 G1 197.01 N 15 76737224 Y392* G T nonsense Het probably null 0.720 08/16/2017
11 486483 UTSW Ash1l 0.444 R6035 G1 225.01 Y 3 88985019 Y1402H T C missense Het probably damaging 0.998 0.222 phenotype 08/16/2017
12 486513 UTSW Carmil2 0.120 R6035 G1 225.01 Y 8 105692563 W749L G T missense Het probably benign 0.272 phenotype 08/16/2017
13 486519 UTSW Ccar1 0.908 R6035 G1 225.01 Y 10 62751785 Y867H A G missense Het unknown 0.076 08/16/2017
14 486514 UTSW Cdh13 0.000 R6035 G1 225.01 Y 8 118505698 D47G A G missense Het probably benign 0.034 phenotype 08/16/2017
15 486551 UTSW Chst9 0.244 R6035 G1 225.01 Y 18 15452853 T218S T A missense Het probably benign 0.129 0.133 phenotype 08/16/2017
16 486502 UTSW Clec2i 0.049 R6035 G1 225.01 Y 6 128893624 V67I G A missense Het probably benign 0.008 0.050 08/16/2017
17 486517 UTSW Cox7a2 0.000 R6035 G1 124.01 N 9 79759746 T A start gained Het probably benign phenotype 08/16/2017
18 501743 UTSW Cpz 0.386 R6035 G1 161.01 N 5 35517585 C107R A G missense Het probably damaging 1.000 phenotype 12/01/2017
19 486533 UTSW Dapk1 0.275 R6035 G1 115.01 Y 13 60761199 C1209S T A missense Het possibly damaging 0.458 phenotype 08/16/2017
20 486532 UTSW Ddx41 0.929 R6035 G1 179.01 Y 13 55533968 M307V T C missense Het probably benign 0.004 phenotype 08/16/2017
21 486510 UTSW Defa24 0.065 R6035 G1 225.01 N 8 21734549 I5V A G missense Het probably benign 0.000 08/16/2017
22 486545 UTSW Dgcr8 1.000 R6035 G1 225.01 Y 16 18258314 N2K A T missense Het probably damaging 1.000 phenotype 08/16/2017
23 486539 UTSW Ebf2 0.854 R6035 G1 225.01 Y 14 67238974 D131G A G missense Het probably damaging 0.999 phenotype 08/16/2017
24 486536 UTSW Fam149b 0.251 R6035 G1 225.01 Y 14 20377917 R424C C T missense Het probably damaging 1.000 08/16/2017
25 486498 UTSW Fbln2 0.000 R6035 G1 204.01 N 6 91263353 V714M G A missense Het probably damaging 1.000 0.162 phenotype 08/16/2017
26 486493 UTSW Fgf5 0.122 R6035 G1 225.01 Y 5 98275526 Y257H T C missense Het probably damaging 1.000 0.196 phenotype 08/16/2017
27 486477 UTSW Fmo3 0.046 R6035 G1 225.01 Y 1 162964036 V224G A C missense Het probably damaging 0.967 phenotype 08/16/2017
28 486475 UTSW Gigyf2 0.751 R6035 G1 225.01 Y 1 87410728 I394T T C missense Het possibly damaging 0.925 phenotype 08/16/2017
29 486494 UTSW Glmn 1.000 R6035 G1 225.01 Y 5 107593880 T A critical splice acceptor site Het probably null 0.540 phenotype 08/16/2017
30 486550 UTSW Greb1l 0.616 R6035 G1 225.01 Y 18 10501025 I385T T C missense Het possibly damaging 0.908 08/16/2017
31 486527 UTSW Grhl1 0.000 R6035 G1 225.01 Y 12 24608450 Q365K C A missense Het probably benign 0.001 phenotype 08/16/2017
32 486496 UTSW Gsdme 0.000 R6035 G1 225.01 Y 6 50229326 T179M G A missense Het probably damaging 0.988 0.023 phenotype 08/16/2017
33 486549 UTSW Gtf2a1l 0.552 R6035 G1 225.01 Y 17 88711534 T349A A G missense Het probably benign 0.001 phenotype 08/16/2017
34 486484 UTSW Hax1 0.286 R6035 G1 217.47 Y 3 89997940 GTCATCATCATCATCATC GTCATCATCATCATCATCATC small insertion Het probably benign 0.071 phenotype 08/16/2017
35 486500 UTSW Il5ra 0.105 R6035 G1 225.01 N 6 106741265 T76I G A missense Het probably damaging 0.997 0.112 phenotype 08/16/2017
36 486479 UTSW Itga8 0.622 R6035 G1 225.01 Y 2 12191714 T631A T C missense Het probably benign 0.000 phenotype 08/16/2017
37 486524 UTSW Kcnh6 0.667 R6035 G1 225.01 Y 11 106019152 G A critical splice donor site 1 bp Het probably null phenotype 08/16/2017
38 486523 UTSW Krt26 0.041 R6035 G1 225.01 Y 11 99333589 E368K C T missense Het probably benign 0.430 phenotype 08/16/2017
39 486476 UTSW Lhx9 0.741 R6035 G1 224.01 N 1 138838543 D169G T C missense Het possibly damaging 0.674 phenotype 08/16/2017
40 486516 UTSW Lman1l 0.034 R6035 G1 225.01 N 9 57611747 A G critical splice donor site 2 bp Het probably null phenotype 08/16/2017
41 486499 UTSW Lmod3 0.274 R6035 G1 225.01 Y 6 97247273 L529P A G missense Het probably damaging 1.000 0.092 phenotype 08/16/2017
42 479120 UTSW Mroh2a 0.924 R6035 G1 106.01 N 1 88230668 V146M G A missense Het probably damaging 1.000 phenotype 06/26/2017
43 486541 UTSW Nup155 1.000 R6035 G1 225.01 Y 15 8144093 T891A A G missense Het probably benign 0.000 phenotype 08/16/2017
44 486521 UTSW Olfr20 0.103 R6035 G1 225.01 Y 11 73353756 M1T T C start codon destroyed Het probably null 0.998 phenotype 08/16/2017
45 486480 UTSW Olfr341 0.078 R6035 G1 225.01 Y 2 36479984 I49F T A missense Het probably damaging 1.000 0.170 phenotype 08/16/2017
46 486522 UTSW Olfr409-ps1 0.111 R6035 G1 225.01 Y 11 74317459 *145R T C makesense Het probably null 08/16/2017
47 486538 UTSW Olfr739 0.052 R6035 G1 225.01 Y 14 50424527 T3A A G missense Het probably benign 0.000 phenotype 08/16/2017
48 486515 UTSW Olfr883 0.098 R6035 G1 217.47 Y 9 38026540 ATTGCTGTTT ATTGCTGTTTGCTGTTT frame shift Het probably null 0.627 phenotype 08/16/2017
49 486528 UTSW Papln 0.129 R6035 G1 225.01 Y 12 83774680 G262A G C missense Het probably damaging 1.000 08/16/2017
50 486554 UTSW Pdcd1lg2 0.039 R6035 G1 225.01 Y 19 29446035 V160I G A missense Het probably benign 0.078 phenotype 08/16/2017
51 486534 UTSW Pde8b 0.185 R6035 G1 225.01 N 13 95027597 A G intron Het probably benign phenotype 08/16/2017
52 486509 UTSW Ppme1 1.000 R6035 G1 225.01 Y 7 100354795 R68* G A nonsense Het probably null phenotype 08/16/2017
53 514472 UTSW Prob1 0.147 R6035 G1 52.01 Y 18 35654782 S140G T C missense Het probably benign 0.177 05/02/2018
54 486529 UTSW Ptprn2 0.468 R6035 G1 225.01 Y 12 117255595 N949Y A T missense Het probably damaging 1.000 phenotype 08/16/2017
55 486481 UTSW Qser1 0.229 R6035 G1 225.01 Y 2 104787123 D1115Y C A missense Het probably damaging 0.993 08/16/2017
56 486487 UTSW Rad54l 0.000 R6035 G1 200.01 Y 4 116097469 D674E G T missense Het probably damaging 0.999 phenotype 08/16/2017
57 486546 UTSW Ripk4 0.212 R6035 G1 225.01 Y 16 97744187 D420V T A missense Het probably damaging 1.000 0.318 phenotype 08/16/2017
58 486518 UTSW Ros1 0.134 R6035 G1 225.01 Y 10 52077971 S1857R G T missense Het probably benign 0.000 phenotype 08/16/2017
59 486508 UTSW Rsf1 0.559 R6035 G1 225.01 Y 7 97662109 E682G A G missense Het probably benign 0.015 phenotype 08/16/2017
60 501745 UTSW Rsf1 0.559 R6035 G1 214.46 N 7 97579904 ATGGCG ATGGCGACGGTGGCG unclassified Het probably benign phenotype 12/01/2017
61 486537 UTSW Samd4 0.618 R6035 G1 220.01 Y 14 47087872 R515H G A missense Het probably damaging 1.000 0.268 phenotype 08/16/2017
62 501741 UTSW Selp 0.231 R6035 G1 225.01 N 1 164141510 W560R T A missense Het probably benign 0.444 phenotype 12/01/2017
63 486531 UTSW Shc3 0.211 R6035 G1 225.01 Y 13 51461432 L163Q A T missense Het probably damaging 1.000 0.024 phenotype 08/16/2017
64 486488 UTSW Shh 1.000 R6035 G1 225.01 Y 5 28461399 A163V G A missense Het probably damaging 0.999 phenotype 08/16/2017
65 486520 UTSW Slc17a8 0.161 R6035 G1 225.01 Y 10 89592075 R113G T C missense Het possibly damaging 0.672 0.075 phenotype 08/16/2017
66 501742 UTSW Slc5a6 0.119 R6035 G1 186.01 N 5 31048824 C A unclassified Het probably benign 12/01/2017
67 486525 UTSW Smarcd2 0.874 R6035 G1 225.01 Y 11 106266889 A G critical splice donor site 2 bp Het probably null phenotype 08/16/2017
68 486547 UTSW Sytl3 0.124 R6035 G1 225.01 Y 17 6728265 D148G A G missense Het probably damaging 1.000 phenotype 08/16/2017
69 486511 UTSW Tnks 0.000 R6035 G1 174.01 Y 8 34918461 H297Q G T missense Het possibly damaging 0.933 phenotype 08/16/2017
70 486495 UTSW Trbv21 0.047 R6035 G1 225.01 N 6 41202634 A T splice site Het probably benign 08/16/2017
71 486489 UTSW Ube3c 0.367 R6035 G1 225.01 Y 5 29601163 F268L T C missense Het probably benign 0.003 08/16/2017
72 486492 UTSW Ugt2b5 0.041 R6035 G1 225.01 Y 5 87139682 I209V T C missense Het probably benign 0.092 0.252 08/16/2017
73 486486 UTSW Usp1 0.761 R6035 G1 225.01 Y 4 98929845 N140S A G missense Het probably damaging 0.999 0.468 phenotype 08/16/2017
74 486485 UTSW Vcam1 0.651 R6035 G1 225.01 Y 3 116125957 Y226C T C missense Het probably damaging 1.000 0.066 phenotype 08/16/2017
75 486505 UTSW Vmn1r129 R6035 G1 210.01 N 7 21360609 Q228L T A missense Het probably damaging 0.985 08/16/2017
76 486530 UTSW Vmn1r209 0.172 R6035 G1 225.01 N 13 22806032 N163Y T A missense Het probably benign 0.020 08/16/2017
77 486504 UTSW Vmn1r85 0.040 R6035 G1 225.01 Y 7 13084927 S97P A G missense Het probably damaging 0.999 08/16/2017
78 501744 UTSW Vmn2r30 R6035 G1 179.01 N 7 7334351 M95I C T missense Het probably benign 0.337 12/01/2017
79 486506 UTSW Vmn2r74 0.153 R6035 G1 225.01 Y 7 85951890 R847C G A missense Het probably damaging 0.980 0.026 08/16/2017
80 486540 UTSW Wdr70 0.948 R6035 G1 225.01 Y 15 7887349 T529I G A missense Het possibly damaging 0.861 0.186 08/16/2017
81 486552 UTSW Zfp532 0.456 R6035 G1 225.01 N 18 65623934 S313A T G missense Het possibly damaging 0.949 08/16/2017
82 486482 UTSW Zhx3 1.000 R6035 G1 225.01 N 2 160779543 N901K A T missense Het probably benign 0.000 phenotype 08/16/2017
[records 1 to 82 of 82]