Incidental Mutations

58 incidental mutations are currently displayed, and affect 58 genes.
8 are Possibly Damaging.
23 are Probably Damaging.
22 are Probably Benign.
3 are Probably Null.
1 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 58 of 58] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 485903 UTSW 4930568D16Rik 0.225 R6091 G1 225.01 Y 2 35362336 T50P T G missense Het possibly damaging 0.768 08/16/2017
2 485907 UTSW Adad1 0.243 R6091 G1 225.01 Y 3 37084969 E396G A G missense Het possibly damaging 0.929 phenotype 08/16/2017
3 485925 UTSW Adamtsl3 0.142 R6091 G1 225.01 Y 7 82465621 C232S T A missense Het probably damaging 0.996 phenotype 08/16/2017
4 485954 UTSW AI606181 0.426 R6091 G1 225.01 Y 19 41593624 S78P T C missense Het unknown 08/16/2017
5 485939 UTSW Amph 0.515 R6091 G1 225.01 Y 13 19125123 M457K T A missense Het probably benign 0.013 0.080 phenotype 08/16/2017
6 485926 UTSW Ano1 1.000 R6091 G1 225.01 Y 7 144669434 M174K A T missense Het probably benign 0.122 0.142 phenotype 08/16/2017
7 485948 UTSW C3 0.000 R6091 G1 213.01 Y 17 57221967 K632* T A nonsense Het probably null 0.606 phenotype 08/16/2017
8 485900 UTSW Cep170 0.479 R6091 G1 225.01 Y 1 176755831 G994D C T missense Het probably damaging 0.984 phenotype 08/16/2017
9 485910 UTSW Chd7 0.959 R6091 G1 225.01 Y 4 8751875 V124A T C missense Het probably damaging 0.989 phenotype 08/16/2017
10 485928 UTSW Chd9 0.527 R6091 G1 186.01 N 8 91035063 K2259E A G missense Het probably damaging 0.998 08/16/2017
11 485931 UTSW Col7a1 1.000 R6091 G1 225.01 Y 9 108955334 T137A A G missense Het unknown phenotype 08/16/2017
12 485951 UTSW Dcc 1.000 R6091 G1 225.01 Y 18 71809114 V311I C T missense Het probably benign 0.005 0.042 phenotype 08/16/2017
13 485937 UTSW Ddx42 0.754 R6091 G1 225.01 Y 11 106234970 Q282L A T missense Het probably damaging 0.997 phenotype 08/16/2017
14 485921 UTSW Fcgbp 0.255 R6091 G1 225.01 Y 7 28104965 T1833A A G missense Het possibly damaging 0.899 08/16/2017
15 485946 UTSW Fpr-rs3 0.141 R6091 G1 225.01 Y 17 20624270 I203T A G missense Het probably benign 0.303 08/16/2017
16 485912 UTSW Frem1 0.671 R6091 G1 225.01 Y 4 82900559 I2139T A G missense Het probably benign 0.012 0.014 phenotype 08/16/2017
17 485941 UTSW Frmpd2 0.169 R6091 G1 225.01 Y 14 33522863 V546A T C missense Het probably damaging 0.981 phenotype 08/16/2017
18 485917 UTSW Gbp11 0.093 R6091 G1 225.01 N 5 105331388 T123N G T missense Het possibly damaging 0.950 08/16/2017
19 485914 UTSW Hs3st1 0.212 R6091 G1 219.01 Y 5 39614664 P212L G A missense Het probably damaging 0.998 phenotype 08/16/2017
20 485913 UTSW Ifnb1 0.159 R6091 G1 225.01 Y 4 88522576 M67L T A missense Het probably benign 0.001 0.125 phenotype 08/16/2017
21 485938 UTSW Ighv1-54 0.232 R6091 G1 225.01 Y 12 115193877 N50S T C missense Het probably benign 0.001 08/16/2017
22 485934 UTSW Ikzf4 0.548 R6091 G1 224.01 Y 10 128634673 T326I G A missense Het probably benign 0.149 phenotype 08/16/2017
23 485936 UTSW Ints2 0.956 R6091 G1 225.01 Y 11 86236603 V501E A T missense Het probably damaging 0.960 0.076 phenotype 08/16/2017
24 485908 UTSW Mfsd1 0.169 R6091 G1 225.01 Y 3 67599937 C A splice site Het probably null 08/16/2017
25 485898 UTSW Mroh2a 0.941 R6091 G1 164.47 Y 1 88232257 GCCC GC frame shift Het probably null phenotype 08/16/2017
26 485924 UTSW Mrps11 0.787 R6091 G1 225.01 Y 7 78788718 A73T G A missense Het possibly damaging 0.866 phenotype 08/16/2017
27 485899 UTSW Mterf4 1.000 R6091 G1 225.01 Y 1 93301569 E311G T C missense Het probably damaging 1.000 phenotype 08/16/2017
28 485944 UTSW Mx2 0.167 R6091 G1 191.01 Y 16 97546435 T176A A G missense Het probably damaging 0.997 phenotype 08/16/2017
29 485942 UTSW Mycbp2 1.000 R6091 G1 225.01 Y 14 103223046 L1495R A C missense Het probably damaging 0.998 0.302 phenotype 08/16/2017
30 485904 UTSW Myo3b 0.739 R6091 G1 225.01 Y 2 70238769 T451A A G missense Het probably benign 0.001 phenotype 08/16/2017
31 485933 UTSW Myrfl 0.333 R6091 G1 225.01 Y 10 116849206 T90A T C missense Het probably benign 0.000 0.024 08/16/2017
32 485896 UTSW Nbeal1 0.438 R6091 G1 130.01 N 1 60181556 A G start gained Het probably benign 08/16/2017
33 485935 UTSW Ncor1 1.000 R6091 G1 225.01 Y 11 62419617 L201P A G missense Het probably damaging 0.975 0.236 phenotype 08/16/2017
34 485916 UTSW Nfxl1 0.274 R6091 G1 225.01 Y 5 72514190 L909I G T missense Het probably benign 0.001 08/16/2017
35 485950 UTSW Nr3c1 1.000 R6091 G1 213.53 N 18 39486958 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC small deletion Het probably benign phenotype 08/16/2017
36 485905 UTSW Olfr1107 0.052 R6091 G1 225.01 Y 2 87071361 S258C T A missense Het probably benign 0.027 phenotype 08/16/2017
37 485930 UTSW Plscr5 0.148 R6091 G1 225.01 Y 9 92204384 T136A A G missense Het probably benign 0.150 0.102 08/16/2017
38 485918 UTSW Ppp1r3a 0.000 R6091 G1 225.01 Y 6 14719340 T525I G A missense Het probably benign 0.018 phenotype 08/16/2017
39 485940 UTSW Ptprg 0.000 R6091 G1 225.01 Y 14 12215979 G1143R G A missense Het probably damaging 1.000 0.314 phenotype 08/16/2017
40 485915 UTSW Rbm47 0.283 R6091 G1 174.01 Y 5 66026283 R326G G C missense Het probably damaging 0.996 0.348 phenotype 08/16/2017
41 485922 UTSW Ryr1 1.000 R6091 G1 225.01 Y 7 29071973 T2541A T C missense Het probably benign 0.015 phenotype 08/16/2017
42 485927 UTSW Sall1 0.932 R6091 G1 225.01 Y 8 89028619 L1244P A G missense Het probably damaging 1.000 phenotype 08/16/2017
43 485902 UTSW Sec16a 0.950 R6091 G1 225.01 Y 2 26426470 H1673Y G A missense Het probably damaging 1.000 phenotype 08/16/2017
44 485952 UTSW Slc22a19 0.075 R6091 G1 225.01 Y 19 7711063 I44T A G missense Het probably benign 0.264 phenotype 08/16/2017
45 485929 UTSW Snap91 0.302 R6091 G1 225.01 Y 9 86839628 N53Y T A missense Het probably damaging 1.000 0.252 phenotype 08/16/2017
46 485955 UTSW Sorcs1 0.169 R6091 G1 225.01 Y 19 50288101 T338A T C missense Het possibly damaging 0.638 phenotype 08/16/2017
47 485953 UTSW Taf6l 0.923 R6091 G1 225.01 Y 19 8778556 T243A T C missense Het probably benign 0.037 phenotype 08/16/2017
48 485911 UTSW Tex10 0.950 R6091 G1 225.01 Y 4 48459891 R487G T C missense Het probably damaging 0.981 phenotype 08/16/2017
49 485943 UTSW Tfcp2 0.000 R6091 G1 203.01 Y 15 100512313 T391N G T missense Het probably damaging 0.996 0.422 phenotype 08/16/2017
50 485947 UTSW Tnxb 0.000 R6091 G1 182.01 Y 17 34710364 V2794M G A missense Het probably damaging 0.975 0.078 phenotype 08/16/2017
51 485901 UTSW Ush2a 0.491 R6091 G1 225.01 Y 1 188399803 C741G T G missense Het probably damaging 1.000 phenotype 08/16/2017
52 485909 UTSW Vmn1r3 0.284 R6091 G1 94.01 N 4 3184684 I208F T A missense Het probably damaging 0.969 08/16/2017
53 485920 UTSW Vmn2r28 0.100 R6091 G1 187.01 N 7 5493791 I21F T A missense Het possibly damaging 0.881 08/16/2017
54 485945 UTSW Vmn2r93 0.189 R6091 G1 225.01 Y 17 18325696 D610G A G missense Het probably benign 0.063 08/16/2017
55 485919 UTSW Wbp1 0.273 R6091 G1 225.01 Y 6 83119487 S229G T C missense Het probably benign 0.433 phenotype 08/16/2017
56 485932 UTSW Xirp1 0.497 R6091 G1 225.01 Y 9 120017963 V618A A G missense Het probably benign 0.012 phenotype 08/16/2017
57 485923 UTSW Zbtb32 0.000 R6091 G1 225.01 Y 7 30591829 S14P A G missense Het possibly damaging 0.483 phenotype 08/16/2017
58 485949 UTSW Zfp24 1.000 R6091 G1 225.01 Y 18 24014212 S348P A G missense Het probably damaging 0.998 phenotype 08/16/2017
[records 1 to 58 of 58]