Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
7 are Possibly Damaging.
26 are Probably Damaging.
22 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 487744 UTSW Akna 0.118 R6176 G1 225.01 Y 4 63377732 Q966R T C missense Het probably benign 0.035 phenotype 10/10/2017
2 487780 UTSW Amn 1.000 R6176 G1 192.01 Y 12 111274156 D74G A G missense Het possibly damaging 0.547 phenotype 10/10/2017
3 487743 UTSW Ank2 1.000 R6176 G1 225.01 Y 3 126945471 T2255S T A missense Het probably benign 0.045 phenotype 10/10/2017
4 487776 UTSW Ankfy1 0.616 R6176 G1 225.01 Y 11 72754459 C788Y G A missense Het probably benign 0.331 0.336 phenotype 10/10/2017
5 487775 UTSW Apaf1 1.000 R6176 G1 225.01 Y 10 91059571 A G critical splice donor site 2 bp Het probably null phenotype 10/10/2017
6 487757 UTSW Asl 0.132 R6176 G1 225.01 Y 5 130018879 H82L T A missense Het probably benign 0.000 0.047 phenotype 10/10/2017
7 487740 UTSW Atrn 0.000 R6176 G1 225.01 Y 2 130946091 E271G A G missense Het probably benign 0.312 phenotype 10/10/2017
8 487761 UTSW B4galnt3 0.059 R6176 G1 225.01 Y 6 120224164 F184S A G missense Het probably damaging 1.000 phenotype 10/10/2017
9 487762 UTSW C1s2 0.119 R6176 G1 225.01 Y 6 124625809 H481L T A missense Het probably damaging 1.000 10/10/2017
10 487758 UTSW Cav2 0.252 R6176 G1 225.01 Y 6 17286919 D58G A G missense Het possibly damaging 0.904 phenotype 10/10/2017
11 487753 UTSW Cc2d2a 0.652 R6176 G1 225.01 Y 5 43709113 H755L A T missense Het probably benign 0.317 0.024 phenotype 10/10/2017
12 501832 UTSW Ccdc65 0.445 R6176 G1 225.01 Y 15 98708552 A G intron 16 bp Het probably null phenotype 12/04/2017
13 487773 UTSW Celsr3 1.000 R6176 G1 225.01 Y 9 108828355 Y679F A T missense Het probably damaging 0.999 phenotype 10/10/2017
14 487754 UTSW Cep135 0.827 R6176 G1 225.01 N 5 76624643 Y625F A T missense Het probably benign 0.000 phenotype 10/10/2017
15 487737 UTSW Cfhr1 0.031 R6176 G1 225.01 Y 1 139550916 S58P A G missense Het probably damaging 1.000 phenotype 10/10/2017
16 487791 UTSW Clip4 0.178 R6176 G1 225.01 Y 17 71806633 C259* T A nonsense Het probably null 10/10/2017
17 487745 UTSW Cyp2j12 0.128 R6176 G1 225.01 Y 4 96140837 Q69L T A missense Het probably damaging 0.992 10/10/2017
18 487787 UTSW Dirc2 0.671 R6176 G1 225.01 Y 16 35704797 M426I C T missense Het probably benign 0.000 phenotype 10/10/2017
19 487772 UTSW Dock3 0.524 R6176 G1 225.01 Y 9 106912948 T1484I G A missense Het probably benign 0.048 0.056 phenotype 10/10/2017
20 487792 UTSW Ecscr 0.000 R6176 G1 122.47 Y 18 35716760 CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT CCTGCTGCTGCTGCTGCTGCTGCTGCTGCT small deletion Het probably benign 0.062 phenotype 10/10/2017
21 487749 UTSW Fam43b 0.225 R6176 G1 89.01 Y 4 138395211 D266G T C missense Het probably damaging 0.985 10/10/2017
22 487752 UTSW Fbxl13 0.000 R6176 G1 225.01 Y 5 21500500 I618F T A missense Het possibly damaging 0.827 0.154 phenotype 10/10/2017
23 487789 UTSW Gm10229 R6176 G1 225.01 N 16 89015400 Y24* T A nonsense Het probably null 10/10/2017
24 487779 UTSW Gm11639 0.216 R6176 G1 225.01 Y 11 104792557 I1604F A T missense Het probably benign 0.160 10/10/2017
25 487751 UTSW Gm13212 0.321 R6176 G1 91.01 N 4 145624058 C688* T A nonsense Het probably null 10/10/2017
26 501830 UTSW Gne 1.000 R6176 G1 162.01 Y 4 44053019 C T intron Het probably benign phenotype 12/04/2017
27 487768 UTSW Gnpat 0.349 R6176 G1 225.01 Y 8 124878854 V321E T A missense Het probably damaging 0.995 0.318 phenotype 10/10/2017
28 487778 UTSW Gpatch8 0.515 R6176 G1 225.01 Y 11 102487524 A200V G A missense Het unknown phenotype 10/10/2017
29 487782 UTSW Grid1 0.137 R6176 G1 225.01 Y 14 35562547 A749E C A missense Het probably benign 0.004 0.088 phenotype 10/10/2017
30 487760 UTSW Grip2 0.000 R6176 G1 91.01 Y 6 91779851 V540I C T missense Het probably benign 0.004 phenotype 10/10/2017
31 487770 UTSW Ice2 0.715 R6176 G1 225.01 Y 9 69417072 T759M C T missense Het probably damaging 0.996 10/10/2017
32 487785 UTSW Jrk 0.250 R6176 G1 225.01 N 15 74706340 N365K G T missense Het possibly damaging 0.473 phenotype 10/10/2017
33 487746 UTSW Kank4 0.099 R6176 G1 225.01 Y 4 98765554 I879T A G missense Het probably damaging 1.000 10/10/2017
34 487747 UTSW Lao1 0.038 R6176 G1 225.01 Y 4 118962000 M1K T A start codon destroyed Het probably null 0.399 phenotype 10/10/2017
35 487741 UTSW Mlf1 0.565 R6176 G1 225.01 Y 3 67384594 R31G A G missense Het probably damaging 0.995 phenotype 10/10/2017
36 501831 UTSW Nt5c3b 0.216 R6176 G1 225.01 Y 11 100440148 T C intron Het probably benign 12/04/2017
37 487739 UTSW Nusap1 1.000 R6176 G1 225.01 Y 2 119630421 R132G A G missense Het probably benign 0.008 phenotype 10/10/2017
38 487777 UTSW Olfr1 0.142 R6176 G1 217.47 Y 11 73395654 AGCGGTCGTAGGC AGC frame shift Het probably null 0.638 phenotype 10/10/2017
39 487738 UTSW Olfr1153 0.089 R6176 G1 225.01 Y 2 87896936 V254I G A missense Het probably benign 0.177 phenotype 10/10/2017
40 487783 UTSW Olfr738 0.123 R6176 G1 225.01 Y 14 50414390 Y282C A G missense Het probably damaging 1.000 0.033 phenotype 10/10/2017
41 487769 UTSW Olfr926 0.062 R6176 G1 225.01 Y 9 38877377 D67A A C missense Het probably damaging 1.000 phenotype 10/10/2017
42 487771 UTSW Paqr9 0.085 R6176 G1 225.01 Y 9 95560775 V273L G T missense Het possibly damaging 0.640 10/10/2017
43 487793 UTSW Pcdha9 0.127 R6176 G1 225.01 Y 18 36998931 D351V A T missense Het probably benign 0.243 0.172 phenotype 10/10/2017
44 487794 UTSW Pcdhga1 0.000 R6176 G1 225.01 Y 18 37664229 D762G A G missense Het probably benign 0.216 0.132 phenotype 10/10/2017
45 487763 UTSW Pde3a 0.240 R6176 G1 225.01 Y 6 141498889 L1141Q T A missense Het possibly damaging 0.956 phenotype 10/10/2017
46 501833 UTSW Pga5 0.048 R6176 G1 225.01 Y 19 10671785 T A splice site 3 bp Het probably null 12/04/2017
47 487765 UTSW Phldb3 0.132 R6176 G1 225.01 Y 7 24626702 R570S C A missense Het probably damaging 1.000 10/10/2017
48 487795 UTSW Slc22a6 0.047 R6176 G1 225.01 Y 19 8621797 E264A A C missense Het probably damaging 1.000 0.506 phenotype 10/10/2017
49 487796 UTSW Slit1 0.000 R6176 G1 225.01 Y 19 41637595 K576R T C missense Het probably damaging 1.000 phenotype 10/10/2017
50 512269 UTSW Sox21 0.000 R6176 G1 64.01 Y 14 118235628 K3R T C missense Het possibly damaging 0.528 phenotype 04/19/2018
51 487767 UTSW Stk32c 0.084 R6176 G1 225.01 Y 7 139120775 D297E A T missense Het probably benign 0.019 0.164 phenotype 10/10/2017
52 487759 UTSW Suclg1 0.427 R6176 G1 225.01 Y 6 73275343 V323A T C missense Het probably damaging 1.000 phenotype 10/10/2017
53 487750 UTSW Tas1r2 0.086 R6176 G1 225.01 Y 4 139668888 C513G T G missense Het probably damaging 1.000 phenotype 10/10/2017
54 487788 UTSW Tbc1d23 0.666 R6176 G1 225.01 Y 16 57171789 Y603H A G missense Het probably damaging 1.000 phenotype 10/10/2017
55 487784 UTSW Tbc1d31 0.747 R6176 G1 225.01 Y 15 57952796 V642A T C missense Het probably damaging 0.987 10/10/2017
56 487774 UTSW Tle2 0.384 R6176 G1 117.01 Y 10 81587334 D486V A T missense Het probably damaging 0.985 10/10/2017
57 487790 UTSW Tmem232 0.116 R6176 G1 225.01 Y 17 65485872 I110T A G missense Het probably damaging 0.999 10/10/2017
58 487748 UTSW Tmem39b 0.390 R6176 G1 84.01 Y 4 129693101 Y106H A G missense Het probably damaging 1.000 10/10/2017
59 487766 UTSW Trpm4 0.337 R6176 G1 225.01 Y 7 45326676 N229T T G missense Het probably damaging 0.999 0.142 phenotype 10/10/2017
60 487786 UTSW Tspo 0.282 R6176 G1 126.01 Y 15 83573806 T120A A G missense Het probably benign 0.000 phenotype 10/10/2017
61 487756 UTSW Ttc28 0.656 R6176 G1 225.01 Y 5 111223985 A767T G A missense Het probably damaging 1.000 0.238 10/10/2017
62 487742 UTSW Usp53 0.365 R6176 G1 225.01 Y 3 122934003 Q977* G A nonsense Het probably null phenotype 10/10/2017
63 487781 UTSW Vmn1r215 0.102 R6176 G1 225.01 Y 13 23076358 D189E T A missense Het probably damaging 1.000 10/10/2017
64 487755 UTSW Vmn2r12 0.169 R6176 G1 225.01 N 5 109086000 Y782C T C missense Het probably benign 0.432 10/10/2017
65 487764 UTSW Vmn2r54 0.086 R6176 G1 225.01 Y 7 12615981 L558P A G missense Het probably damaging 1.000 10/10/2017
[records 1 to 65 of 65]