Incidental Mutations

35 incidental mutations are currently displayed, and affect 35 genes.
6 are Possibly Damaging.
15 are Probably Damaging.
11 are Probably Benign.
3 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 35 of 35] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 503153 UTSW Abca8a 0.100 R6200 G1 225.01 Y 11 110090050 Y54C T C missense Het probably damaging 0.980 02/27/2018
2 503137 UTSW Ash1l 0.408 R6200 G1 225.01 Y 3 89070527 H2719R A G missense Het probably damaging 0.997 0.366 phenotype 02/27/2018
3 503142 UTSW Atraid 0.226 R6200 G1 225.01 Y 5 31052866 N127D A G missense Het probably damaging 1.000 0.204 phenotype 02/27/2018
4 503141 UTSW Capzb 0.915 R6200 G1 225.01 Y 4 139280013 V145A T C missense Het probably benign 0.334 0.302 phenotype 02/27/2018
5 503159 UTSW Cldn17 0.109 R6200 G1 225.01 Y 16 88506571 L90R A C missense Het probably damaging 1.000 0.314 phenotype 02/27/2018
6 503139 UTSW Dab1 0.635 R6200 G1 225.01 Y 4 104731751 A524V C T missense Het probably benign 0.289 0.212 phenotype 02/27/2018
7 503155 UTSW Fancc 0.808 R6200 G1 225.01 Y 13 63360248 L158V A C missense Het probably damaging 1.000 0.198 phenotype 02/27/2018
8 503130 UTSW Fcamr 0.080 R6200 G1 225.01 Y 1 130803190 L60P T C missense Het probably benign 0.160 phenotype 02/27/2018
9 503143 UTSW G6pd2 0.540 R6200 G1 225.01 Y 5 61809871 R330C C T missense Het probably benign 0.002 02/27/2018
10 503132 UTSW Gm16432 0.208 R6200 G1 225.01 Y 1 178111558 N666D A G missense Het possibly damaging 0.659 02/27/2018
11 503131 UTSW Gm4788 0.093 R6200 G1 225.01 Y 1 139754335 R174S T A missense Het probably damaging 0.968 02/27/2018
12 503133 UTSW Gpr158 0.073 R6200 G1 225.01 Y 2 21399416 N333I A T missense Het probably damaging 0.972 02/27/2018
13 503149 UTSW Herpud2 0.149 R6200 G1 225.01 Y 9 25150834 Y45H A G missense Het probably damaging 1.000 02/27/2018
14 503148 UTSW Icam5 0.000 R6200 G1 225.01 Y 9 21038749 Y868C A G missense Het probably damaging 0.997 phenotype 02/27/2018
15 503158 UTSW Krt1 0.270 R6200 G1 111.53 N 15 101850378 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC small deletion Homo probably benign 0.068 phenotype 02/27/2018
16 503140 UTSW Luzp1 1.000 R6200 G1 225.01 Y 4 136541266 Q267K C A missense Het probably benign 0.122 phenotype 02/27/2018
17 503144 UTSW Nkpd1 0.048 R6200 G1 225.01 Y 7 19524603 A769E C A missense Het possibly damaging 0.553 0.144 02/27/2018
18 503146 UTSW Olfr482 0.059 R6200 G1 217.47 Y 7 108095525 AACTCTGTCACT AACT frame shift Het probably null phenotype 02/27/2018
19 503135 UTSW Pabpc4l 0.111 R6200 G1 225.01 Y 3 46446703 V169L C A missense Het probably damaging 0.999 0.028 02/27/2018
20 503163 UTSW Pcdhga7 0.232 R6200 G1 225.01 Y 18 37716082 N381D A G missense Het probably damaging 0.993 0.278 phenotype 02/27/2018
21 503156 UTSW Pcsk1 1.000 R6200 G1 225.01 Y 13 75115255 N372Y A T missense Het possibly damaging 0.883 0.160 phenotype 02/27/2018
22 503161 UTSW Ppp1r21 0.396 R6200 G1 225.01 Y 17 88569185 T475M C T missense Het possibly damaging 0.652 02/27/2018
23 503134 UTSW Prpf40a 0.829 R6200 G1 225.01 Y 2 53157915 M197V T C missense Het probably benign 0.069 0.066 02/27/2018
24 503162 UTSW Psd2 0.128 R6200 G1 225.01 Y 18 36006723 G A splice site 5 bp Het probably null 0.610 02/27/2018
25 503138 UTSW Psip1 0.483 R6200 G1 225.01 Y 4 83474373 K100E T C missense Het probably benign 0.201 phenotype 02/27/2018
26 503154 UTSW Pxdn 0.294 R6200 G1 225.01 Y 12 30003112 H1096R A G missense Het probably damaging 0.999 phenotype 02/27/2018
27 503145 UTSW Rsf1 0.597 R6200 G1 217.47 N 7 97579925 GCGGCGGCG GCGGCGGCGTCGGCGGCG unclassified Het probably benign phenotype 02/27/2018
28 503157 UTSW Slc16a8 0.169 R6200 G1 225.01 Y 15 79252937 G91D C T missense Het probably damaging 1.000 0.628 phenotype 02/27/2018
29 503151 UTSW Slc22a21 0.106 R6200 G1 225.01 N 11 53958038 I296N A T missense Het probably damaging 1.000 phenotype 02/27/2018
30 503136 UTSW Smad9 0.000 R6200 G1 225.01 Y 3 54789186 D224G A G missense Het probably benign 0.000 0.186 phenotype 02/27/2018
31 503150 UTSW Tle2 0.416 R6200 G1 225.01 Y 10 81588872 V678M G A missense Het probably damaging 0.999 0.360 02/27/2018
32 503164 UTSW Tmc1 0.067 R6200 G1 225.01 Y 19 20789590 R749Q C T missense Het possibly damaging 0.533 phenotype 02/27/2018
33 503147 UTSW Tmco3 0.000 R6200 G1 225.01 Y 8 13292077 T A unclassified Het probably null 0.188 02/27/2018
34 503152 UTSW Tspoap1 0.000 R6200 G1 225.01 Y 11 87761703 E101G A G missense Het possibly damaging 0.845 0.068 Rimbp2tm1.2Geno does not exacerbate the phenotype of the latter single KO. [provided by MGI curators] (source: MGI)">phenotype 02/27/2018
35 503160 UTSW Zfp57 0.705 R6200 G1 225.01 Y 17 37010411 T386S A T missense Het probably benign 0.000 0.102 phenotype 02/27/2018
[records 1 to 35 of 35]