Incidental Mutations

72 incidental mutations are currently displayed, and affect 72 genes.
15 are Possibly Damaging.
25 are Probably Damaging.
24 are Probably Benign.
8 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 72 of 72] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 503200 UTSW 4930451I11Rik R6207 G1 225.01 N 7 126830893 P69S G A missense Het probably damaging 1.000 02/27/2018
2 503199 UTSW Abca15 0.086 R6207 G1 225.01 N 7 120373794 R864G A G missense Het probably benign 0.014 02/27/2018
3 503168 UTSW Acbd5 0.264 R6207 G1 225.01 N 2 23069478 C15R T C missense Het possibly damaging 0.584 phenotype 02/27/2018
4 503167 UTSW Ahctf1 1.000 R6207 G1 225.01 N 1 179777390 A T intron 113 bp Het probably null phenotype 02/27/2018
5 503235 UTSW Ak3 0.483 R6207 G1 225.01 N 19 29022940 K190N T A missense Het probably damaging 0.994 phenotype 02/27/2018
6 503188 UTSW B4galnt3 0.059 R6207 G1 225.01 N 6 120206614 A T splice site Het probably null phenotype 02/27/2018
7 503172 UTSW Calcrl 1.000 R6207 G1 225.01 N 2 84333530 H439R T C missense Het probably benign 0.002 phenotype 02/27/2018
8 503236 UTSW Casp7 0.000 R6207 G1 225.01 N 19 56441020 D279E T A missense Het possibly damaging 0.534 phenotype 02/27/2018
9 503181 UTSW Cckar 0.131 R6207 G1 225.01 N 5 53699844 V337A A G missense Het probably benign 0.000 phenotype 02/27/2018
10 503208 UTSW Cep85l 0.344 R6207 G1 225.01 N 10 53281555 Y684C T C missense Het probably benign 0.000 phenotype 02/27/2018
11 503202 UTSW Cmtm1 0.455 R6207 G1 112.47 N 8 104309470 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT small deletion Homo probably benign 02/27/2018
12 503174 UTSW Commd7 0.321 R6207 G1 114.01 N 2 153632610 N23S T C missense Het possibly damaging 0.725 02/27/2018
13 503187 UTSW Cpne9 0.299 R6207 G1 225.01 N 6 113294773 I365F A T missense Het possibly damaging 0.878 02/27/2018
14 503179 UTSW Dab1 0.705 R6207 G1 225.01 N 4 104731751 A524V C T missense Het probably benign 0.289 0.212 phenotype 02/27/2018
15 503211 UTSW Dot1l 1.000 R6207 G1 225.01 N 10 80786443 A831V C T missense Het probably benign 0.064 phenotype 02/27/2018
16 503230 UTSW Epcam 1.000 R6207 G1 225.01 N 17 87640436 N111K C A missense Het probably damaging 1.000 phenotype 02/27/2018
17 503189 UTSW Etnk1 0.952 R6207 G1 225.01 N 6 143180798 Q123R A G missense Het probably damaging 0.989 phenotype 02/27/2018
18 503231 UTSW Fam170a 0.023 R6207 G1 225.01 N 18 50281950 E221V A T missense Het probably damaging 0.990 02/27/2018
19 503234 UTSW Fam189a2 0.158 R6207 G1 225.01 N 19 23973438 E593G T C missense Het probably damaging 1.000 02/27/2018
20 503191 UTSW Fbl 1.000 R6207 G1 225.01 N 7 28174853 S88P T C missense Het possibly damaging 0.864 phenotype 02/27/2018
21 503166 UTSW Fbxo36 0.251 R6207 G1 225.01 N 1 84896530 Y82* T A nonsense Het probably null phenotype 02/27/2018
22 503165 UTSW Fer1l5 0.176 R6207 G1 225.01 N 1 36385160 K285R A G missense Het probably damaging 1.000 02/27/2018
23 503220 UTSW Foxn3 0.914 R6207 G1 225.01 N 12 99196310 T444K G T missense Het probably damaging 0.999 phenotype 02/27/2018
24 503182 UTSW Gak 1.000 R6207 G1 225.01 N 5 108625029 C T critical splice donor site 1 bp Het probably null phenotype 02/27/2018
25 503207 UTSW Gprc6a 0.000 R6207 G1 225.01 N 10 51626835 I311V T C missense Het probably benign 0.361 phenotype 02/27/2018
26 503224 UTSW Hrg 0.300 R6207 G1 225.01 N 16 22954538 T C critical splice donor site 2 bp Het probably null phenotype 02/27/2018
27 503194 UTSW Htatip2 0.585 R6207 G1 225.01 N 7 49770819 V138I G A missense Het probably benign 0.002 phenotype 02/27/2018
28 503221 UTSW Ighv1-4 0.221 R6207 G1 225.01 N 12 114487522 A T critical splice donor site Het probably benign 02/27/2018
29 503176 UTSW Kcnq2 1.000 R6207 G1 225.01 N 2 181113233 M174V T C missense Het possibly damaging 0.485 phenotype 02/27/2018
30 503219 UTSW Krt39 0.354 R6207 G1 225.01 N 11 99521215 P15Q G T missense Het probably damaging 0.995 phenotype 02/27/2018
31 503178 UTSW L1td1 0.134 R6207 G1 225.01 N 4 98737418 D617N G A missense Het possibly damaging 0.548 phenotype 02/27/2018
32 503212 UTSW Lgalsl 0.339 R6207 G1 225.01 N 11 20829382 K88* T A nonsense Het probably null 02/27/2018
33 503209 UTSW Lims1 1.000 R6207 G1 225.01 N 10 58394564 K49M A T missense Het possibly damaging 0.764 phenotype 02/27/2018
34 503228 UTSW Man2a1 0.774 R6207 G1 225.01 N 17 64713605 V792A T C missense Het probably benign 0.024 phenotype 02/27/2018
35 503186 UTSW Mcm2 1.000 R6207 G1 225.01 N 6 88885862 D749E G T missense Het probably benign 0.003 phenotype 02/27/2018
36 503227 UTSW Mdga1 0.513 R6207 G1 225.01 N 17 29838517 T775M G A missense Het probably damaging 0.999 phenotype 02/27/2018
37 503206 UTSW Myb 1.000 R6207 G1 225.01 N 10 21145322 S403P A G missense Het probably benign 0.000 phenotype 02/27/2018
38 503170 UTSW Nek6 0.242 R6207 G1 225.01 N 2 38557834 S37P T C missense Het possibly damaging 0.823 phenotype 02/27/2018
39 503204 UTSW Olfr149 0.051 R6207 G1 225.01 N 9 39702310 H153R T C missense Het probably benign 0.057 phenotype 02/27/2018
40 503195 UTSW Olfr310 0.088 R6207 G1 225.01 N 7 86269760 F10V A C missense Het probably damaging 1.000 phenotype 02/27/2018
41 503196 UTSW Olfr622 0.050 R6207 G1 225.01 N 7 103640002 V46A A G missense Het probably benign 0.290 phenotype 02/27/2018
42 503198 UTSW Olfr663 0.626 R6207 G1 225.01 N 7 104703611 V15M G A missense Het probably damaging 0.962 02/27/2018
43 503184 UTSW Peg10 1.000 R6207 G1 189.47 N 6 4756449 GAT GATCAT small insertion Het probably benign 0.130 phenotype 02/27/2018
44 503171 UTSW Prpf40a 0.841 R6207 G1 225.01 N 2 53157915 M197V T C missense Het probably benign 0.069 0.066 02/27/2018
45 503233 UTSW Prune2 0.108 R6207 G1 225.01 N 19 17118116 I328N T A missense Het probably damaging 1.000 phenotype 02/27/2018
46 503210 UTSW Psap 1.000 R6207 G1 225.01 N 10 60300538 C484S T A missense Het probably damaging 1.000 phenotype 02/27/2018
47 503183 UTSW Pus1 0.307 R6207 G1 225.01 N 5 110777714 D80G T C missense Het probably benign 0.123 phenotype 02/27/2018
48 503201 UTSW Rasa3 1.000 R6207 G1 225.01 N 8 13598251 T138A T C missense Het possibly damaging 0.673 phenotype 02/27/2018
49 503193 UTSW Scaf1 0.866 R6207 G1 225.01 N 7 45007623 G T unclassified Het probably benign 02/27/2018
50 503217 UTSW Skap1 0.136 R6207 G1 225.01 N 11 96704133 Y143* T A nonsense Het probably null phenotype 02/27/2018
51 503232 UTSW Slc22a20 0.153 R6207 G1 225.01 N 19 5985941 L67P A G missense Het probably damaging 1.000 02/27/2018
52 503223 UTSW Slc25a17 0.224 R6207 G1 225.01 N 15 81329064 Y146C T C missense Het probably damaging 1.000 phenotype 02/27/2018
53 503215 UTSW Slfn4 0.048 R6207 G1 225.01 N 11 83189125 T154I C T missense Het possibly damaging 0.819 phenotype 02/27/2018
54 503175 UTSW Snai1 1.000 R6207 G1 183.01 N 2 167538309 V7D T A missense Het probably damaging 0.972 phenotype 02/27/2018
55 503173 UTSW Snrnp200 1.000 R6207 G1 225.01 N 2 127210735 M84K T A missense Het probably benign 0.001 phenotype 02/27/2018
56 503216 UTSW Spop 1.000 R6207 G1 225.01 N 11 95471237 K31N G T missense Het possibly damaging 0.750 phenotype 02/27/2018
57 503169 UTSW Surf1 0.325 R6207 G1 225.01 N 2 26914807 T145A T C missense Het probably benign 0.151 phenotype 02/27/2018
58 503218 UTSW Tbkbp1 0.000 R6207 G1 225.01 N 11 97146339 E278G T C missense Het probably damaging 0.995 phenotype 02/27/2018
59 503229 UTSW Thumpd2 0.068 R6207 G1 225.01 N 17 81055837 A67V G A missense Het probably damaging 1.000 02/27/2018
60 503213 UTSW Timd4 0.070 R6207 G1 225.01 N 11 46815526 M52L A T missense Het probably damaging 0.982 phenotype 02/27/2018
61 503222 UTSW Trav16 0.025 R6207 G1 225.01 N 14 53743588 N78I A T missense Het probably damaging 0.979 02/27/2018
62 503185 UTSW Tspan12 0.271 R6207 G1 225.01 N 6 21799908 T147A T C missense Het probably damaging 0.996 phenotype 02/27/2018
63 503226 UTSW Tulp1 0.740 R6207 G1 225.01 N 17 28358677 A T unclassified Het probably benign phenotype 02/27/2018
64 503197 UTSW Ubqlnl 0.072 R6207 G1 225.01 N 7 104148708 N527K A T missense Het possibly damaging 0.734 phenotype 02/27/2018
65 503180 UTSW Ubr4 1.000 R6207 G1 225.01 N 4 139421248 C1681Y G A missense Het probably damaging 1.000 phenotype 02/27/2018
66 503205 UTSW Unc13c 0.339 R6207 G1 225.01 N 9 73758628 K1037E T C missense Het possibly damaging 0.891 phenotype 02/27/2018
67 503225 UTSW Vmn2r111 0.103 R6207 G1 225.01 N 17 22559051 N549S T C missense Het possibly damaging 0.502 0.068 02/27/2018
68 503177 UTSW Vmn2r4 0.045 R6207 G1 225.01 N 3 64406505 H352Y G A missense Het probably damaging 0.999 02/27/2018
69 503192 UTSW Vmn2r61 0.105 R6207 G1 225.01 N 7 42260192 H47L A T missense Het probably benign 0.007 02/27/2018
70 503203 UTSW Vwa5a 0.104 R6207 G1 225.01 N 9 38722672 E57G A G missense Het probably damaging 0.999 02/27/2018
71 503190 UTSW Zfp180 0.337 R6207 G1 204.01 N 7 24105085 R310* A T nonsense Het probably null phenotype 02/27/2018
72 503214 UTSW Zfp672 0.200 R6207 G1 225.01 N 11 58317523 T C start gained Het probably benign 02/27/2018
[records 1 to 72 of 72]