Incidental Mutations

77 incidental mutations are currently displayed, and affect 74 genes.
10 are Possibly Damaging.
31 are Probably Damaging.
21 are Probably Benign.
14 are Probably Null.
5 create premature stop codons.
5 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 77 of 77] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 506466 UTSW 5430403G16Rik 0.096 R6258 G1 186.01 Y 5 109676567 H339R T C missense Het probably benign 0.006 03/15/2018
2 506476 UTSW Adamtsl3 0.000 R6258 G1 225.01 Y 7 82528983 T C critical splice donor site 2 bp Het probably null 0.576 phenotype 03/15/2018
3 506469 UTSW Alms1 0.000 R6258 G1 225.01 Y 6 85628735 K2456* A T nonsense Het probably null 0.660 phenotype 03/15/2018
4 506441 UTSW Alppl2 0.126 R6258 G1 225.01 Y 1 87088462 M225K A T missense Het probably damaging 0.999 0.504 phenotype 03/15/2018
5 506484 UTSW AU041133 0.091 R6258 G1 225.01 Y 10 82151158 E215G A G missense Het probably damaging 1.000 0.172 03/15/2018
6 506501 UTSW Carmil3 0.560 R6258 G1 225.01 Y 14 55500432 L815Q T A missense Het probably damaging 0.995 03/15/2018
7 506508 UTSW Casr 1.000 R6258 G1 225.01 Y 16 36517609 C60R A G missense Het probably damaging 1.000 phenotype 03/15/2018
8 506465 UTSW Cdc7 1.000 R6258 G1 225.01 Y 5 106969227 K84E A G missense Het probably damaging 1.000 phenotype 03/15/2018
9 506445 UTSW Cdc73 1.000 R6258 G1 225.01 Y 1 143691473 T104I G A missense Het probably benign 0.325 0.166 phenotype 03/15/2018
10 506459 UTSW Clcc1 1.000 R6258 G1 225.01 Y 3 108673308 V313I G A missense Het possibly damaging 0.732 0.168 phenotype 03/15/2018
11 506470 UTSW Cntn3 0.000 R6258 G1 225.01 Y 6 102277217 A G critical splice donor site 2 bp Het probably null 0.624 03/15/2018
12 506442 UTSW Crocc2 0.073 R6258 G1 180.01 Y 1 93213638 K1171R A G missense Het possibly damaging 0.568 0.062 03/15/2018
13 506455 UTSW Ctsa 0.256 R6258 G1 225.01 Y 2 164834361 V86A T C missense Het probably damaging 0.998 0.352 phenotype 03/15/2018
14 506474 UTSW Cyp2s1 0.000 R6258 G1 100.47 N 7 25816442 ACAGCAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAGCAG unclassified Het probably benign phenotype 03/15/2018
15 506461 UTSW Dab1 0.873 R6258 G1 225.01 Y 4 104731751 A524V C T missense Het probably benign 0.289 0.212 phenotype 03/15/2018
16 506491 UTSW Dnah17 0.000 R6258 G1 100.01 Y 11 118126322 W197C C A missense Het probably damaging 1.000 0.562 phenotype 03/15/2018
17 506492 UTSW Dnah17 0.000 R6258 G1 106.01 Y 11 118126323 W197* C T nonsense Het probably null 0.580 phenotype 03/15/2018
18 506493 UTSW Dnah17 0.000 R6258 G1 135.01 Y 11 118126324 W197R A T missense Het probably damaging 1.000 0.524 phenotype 03/15/2018
19 506502 UTSW Egflam 0.000 R6258 G1 225.01 Y 15 7234292 T726S T A missense Het probably damaging 0.979 phenotype 03/15/2018
20 506473 UTSW Eml2 0.000 R6258 G1 185.01 Y 7 19179364 T G unclassified Het probably null 03/15/2018
21 506500 UTSW Ercc6 0.430 R6258 G1 225.01 Y 14 32557856 D609E T A missense Het probably benign 0.002 0.100 phenotype 03/15/2018
22 506509 UTSW Erg 1.000 R6258 G1 225.01 Y 16 95380241 R147L C A missense Het probably damaging 0.991 0.182 phenotype 03/15/2018
23 506482 UTSW Faiml 0.224 R6258 G1 225.01 Y 9 99232460 I125M T C missense Het possibly damaging 0.799 03/15/2018
24 506468 UTSW Fbxo41 0.296 R6258 G1 166.01 Y 6 85478555 L549H A T missense Het probably damaging 1.000 0.064 phenotype 03/15/2018
25 506449 UTSW Fbxw2 0.000 R6258 G1 225.01 Y 2 34812813 A T critical splice donor site 2 bp Het probably null 0.622 phenotype 03/15/2018
26 506486 UTSW Fgd6 0.432 R6258 G1 225.01 Y 10 94044299 N338K T A missense Het probably benign 0.005 03/15/2018
27 506494 UTSW Gaa 0.595 R6258 G1 225.01 Y 11 119281171 A700D C A missense Het probably benign 0.014 0.087 phenotype 03/15/2018
28 506453 UTSW Gm14085 0.079 R6258 G1 225.01 Y 2 122523482 I530F A T missense Het probably damaging 0.997 0.508 03/15/2018
29 506480 UTSW Gm32742 0.230 R6258 G1 225.01 Y 9 51157562 I200F T A missense Het probably damaging 0.963 0.030 03/15/2018
30 506503 UTSW Gm35339 0.111 R6258 G1 225.01 Y 15 76355695 S277* C A nonsense Het probably null 03/15/2018
31 506485 UTSW Gm4924 0.156 R6258 G1 169.01 N 10 82377473 T G intron Het probably benign 03/15/2018
32 506514 UTSW Gm8369 0.081 R6258 G1 225.01 Y 19 11511609 A87T G A missense Het possibly damaging 0.934 03/15/2018
33 506510 UTSW H2-M10.1 0.080 R6258 G1 225.01 Y 17 36324102 I304F T A missense Het unknown 03/15/2018
34 506496 UTSW Ighv5-8 0.163 R6258 G1 225.01 Y 12 113654991 T9A A G missense Het possibly damaging 0.659 0.069 03/15/2018
35 506490 UTSW Itgb4 1.000 R6258 G1 225.01 Y 11 115984157 R447W C T missense Het probably benign 0.002 0.048 phenotype 03/15/2018
36 506463 UTSW Jakmip1 0.597 R6258 G1 225.01 Y 5 37141760 E775* G T nonsense Het probably null phenotype 03/15/2018
37 526457 UTSW Klhl40 0.180 R6258 G1 78.01 Y 9 121777960 F62S T C missense Het probably damaging 0.998 phenotype 06/30/2018
38 506462 UTSW Krtcap3 0.365 R6258 G1 225.01 Y 5 31252228 R84W A T missense Het probably damaging 0.993 03/15/2018
39 506444 UTSW Lgr6 0.000 R6258 G1 225.01 Y 1 134994010 A199T C T missense Het probably damaging 1.000 0.308 phenotype 03/15/2018
40 506475 UTSW Lins1 0.072 R6258 G1 225.01 Y 7 66710748 T C critical splice donor site 2 bp Het probably null 0.424 phenotype 03/15/2018
41 506458 UTSW Magi3 0.298 R6258 G1 225.01 Y 3 104089596 L211P A G missense Het probably damaging 1.000 0.274 03/15/2018
42 506481 UTSW Map2k5 1.000 R6258 G1 225.01 Y 9 63217365 I359F T A missense Het probably benign 0.155 0.124 phenotype 03/15/2018
43 506495 UTSW Map4k5 0.000 R6258 G1 225.01 Y 12 69831562 R355L C A missense Het probably benign 0.058 phenotype 03/15/2018
44 506498 UTSW Mef2c 1.000 R6258 G1 225.01 Y 13 83652938 D252E T A missense Het probably damaging 0.998 0.278 phenotype 03/15/2018
45 506507 UTSW Methig1 0.136 R6258 G1 225.01 N 15 100353541 V111A T C missense Het possibly damaging 0.767 03/15/2018
46 506471 UTSW Mical3 0.166 R6258 G1 225.01 Y 6 121009030 L150Q A T missense Het probably damaging 1.000 0.322 03/15/2018
47 506488 UTSW Nf1 1.000 R6258 G1 225.01 Y 11 79565755 A T intron Het probably null phenotype 03/15/2018
48 506499 UTSW Nisch 0.000 R6258 G1 158.01 Y 14 31177128 T A unclassified Het probably benign 0.080 phenotype 03/15/2018
49 506450 UTSW Olfr1309 0.294 R6258 G1 225.01 Y 2 111984051 V8I C T missense Het probably benign 0.048 0.129 phenotype 03/15/2018
50 506477 UTSW Olfr485 0.156 R6258 G1 225.01 Y 7 108158974 N300D T C missense Het probably damaging 0.999 phenotype 03/15/2018
51 506512 UTSW Pcdhb12 0.070 R6258 G1 225.01 Y 18 37436839 V346A T C missense Het probably benign 0.003 03/15/2018
52 506483 UTSW Pde7b 0.000 R6258 G1 225.01 Y 10 20440800 D168G T C missense Het possibly damaging 0.929 0.042 phenotype 03/15/2018
53 506506 UTSW Pdzrn4 0.260 R6258 G1 225.01 Y 15 92757681 E485V A T missense Het probably damaging 0.999 0.256 03/15/2018
54 506446 UTSW Pla2g4a 0.315 R6258 G1 225.01 Y 1 149857487 S504P A G missense Het probably benign 0.001 0.131 phenotype 03/15/2018
55 506460 UTSW Plin2 0.268 R6258 G1 225.01 Y 4 86657289 A341D G T missense Het probably damaging 0.968 0.172 phenotype 03/15/2018
56 506511 UTSW Psma8 0.202 R6258 G1 225.01 Y 18 14721267 D68G A G missense Het probably damaging 0.999 03/15/2018
57 506447 UTSW Rcor3 0.562 R6258 G1 225.01 Y 1 192124259 H207Y G A missense Het probably benign 0.266 0.190 03/15/2018
58 506457 UTSW Rptn 0.091 R6258 G1 225.01 Y 3 93398130 H923Q C G missense Het possibly damaging 0.533 0.042 03/15/2018
59 506451 UTSW Ryr3 0.478 R6258 G1 225.01 Y 2 112660104 F3795S A G missense Het probably damaging 1.000 0.482 phenotype 03/15/2018
60 506504 UTSW Samm50 0.961 R6258 G1 225.01 Y 15 84200311 P150A C G missense Het probably damaging 0.998 phenotype 03/15/2018
61 506505 UTSW Samm50 0.961 R6258 G1 225.01 Y 15 84200312 P150H C A missense Het probably damaging 0.978 phenotype 03/15/2018
62 506497 UTSW Slc6a18 0.000 R6258 G1 225.01 Y 13 73670045 C284* A T nonsense Het probably null phenotype 03/15/2018
63 506515 UTSW Smc3 1.000 R6258 G1 153.01 Y 19 53627731 T A intron Het probably null phenotype 03/15/2018
64 506454 UTSW Snrnp200 1.000 R6258 G1 225.01 Y 2 127218423 G529D G A missense Het possibly damaging 0.599 0.226 phenotype 03/15/2018
65 506452 UTSW Sord 0.000 R6258 G1 180.01 Y 2 122259132 T A critical splice donor site 2 bp Het probably null 0.590 phenotype 03/15/2018
66 506487 UTSW Spdl1 0.896 R6258 G1 225.01 Y 11 34819886 N345I T A missense Het probably damaging 0.974 0.027 phenotype 03/15/2018
67 506456 UTSW Sucnr1 0.060 R6258 G1 225.01 Y 3 60086357 L102P T C missense Het probably damaging 1.000 0.568 phenotype 03/15/2018
68 506479 UTSW Tbc1d9 0.242 R6258 G1 225.01 Y 8 83210516 W76R T C missense Het probably damaging 0.999 0.114 03/15/2018
69 506513 UTSW Tcerg1 1.000 R6258 G1 225.01 Y 18 42553465 Y696N T A missense Het probably damaging 1.000 phenotype 03/15/2018
70 506443 UTSW Thsd7b 0.211 R6258 G1 225.01 N 1 129667918 T492A A G missense Het probably benign 0.000 03/15/2018
71 506448 UTSW Trdmt1 0.279 R6258 G1 225.01 Y 2 13520059 Q195L T A missense Het probably benign 0.006 phenotype 03/15/2018
72 526456 UTSW Ubr3 1.000 R6258 G1 58.01 Y 2 69982864 A G intron Het probably null 0.655 phenotype 06/30/2018
73 506467 UTSW Ung 0.887 R6258 G1 225.01 Y 5 114137300 Y250F A T missense Het probably benign 0.121 phenotype 03/15/2018
74 506489 UTSW Vezf1 1.000 R6258 G1 225.01 Y 11 88081500 N229S A G missense Het probably damaging 0.995 phenotype 03/15/2018
75 506464 UTSW Wdfy3 0.887 R6258 G1 171.01 Y 5 101872965 R2491Q C T missense Het possibly damaging 0.928 phenotype 03/15/2018
76 506478 UTSW Zfp709 0.238 R6258 G1 217.47 Y 8 71890708 TCGACG TCG small deletion Het probably benign 0.062 phenotype 03/15/2018
77 506472 UTSW Zscan4-ps1 0.177 R6258 G1 225.01 Y 7 11065902 E353D C A missense Het probably benign 0.002 03/15/2018
[records 1 to 77 of 77]