Incidental Mutations

38 incidental mutations are currently displayed, and affect 38 genes.
4 are Possibly Damaging.
14 are Probably Damaging.
14 are Probably Benign.
5 are Probably Null.
3 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 38 of 38] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 519205 UTSW Atp13a3 0.320 R6446 G1 225.01 Y 16 30361869 L114P A G missense Het probably benign 0.004 0.047 phenotype 05/24/2018
2 519192 UTSW Blm 1.000 R6446 G1 111.47 N 7 80512904 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCCTCCTCC small deletion Het probably benign phenotype 05/24/2018
3 519190 UTSW Catsperg1 0.141 R6446 G1 225.01 N 7 29206567 I196V T C missense Het probably benign 0.001 05/24/2018
4 519199 UTSW Cbx2 0.750 R6446 G1 225.01 Y 11 119027926 S106T T A missense Het probably benign 0.080 phenotype 05/24/2018
5 519203 UTSW Ccar2 0.383 R6446 G1 225.01 Y 14 70143069 E354V T A missense Het probably benign 0.306 phenotype 05/24/2018
6 519197 UTSW Ccr1 0.162 R6446 G1 225.01 Y 9 123964106 I129T A G missense Het probably damaging 0.985 0.316 phenotype 05/24/2018
7 519183 UTSW Cdkl2 0.167 R6446 G1 225.01 Y 5 92033217 I188F T A missense Het probably damaging 0.998 0.132 phenotype 05/24/2018
8 519177 UTSW Cep350 0.838 R6446 G1 225.01 Y 1 155862154 N2648D T C missense Het probably benign 0.000 phenotype 05/24/2018
9 519210 UTSW Chtf18 0.358 R6446 G1 213.01 Y 17 25721244 S658P A G missense Het probably benign 0.014 0.020 phenotype 05/24/2018
10 519207 UTSW Csnka2ip 0.142 R6446 G1 225.01 Y 16 64479381 Q207* G A nonsense Het probably null 05/24/2018
11 519194 UTSW Dennd5a 0.193 R6446 G1 141.01 Y 7 109894666 L1253P A G missense Het probably damaging 1.000 phenotype 05/24/2018
12 519202 UTSW Dennd6a 0.216 R6446 G1 225.01 Y 14 26629534 I374K T A missense Het probably damaging 0.998 0.290 05/24/2018
13 519178 UTSW Dut 0.971 R6446 G1 225.01 Y 2 125251019 T C critical splice donor site 2 bp Het probably null 0.502 phenotype 05/24/2018
14 519195 UTSW Gcm1 1.000 R6446 G1 225.01 Y 9 78059783 Y95H T C missense Het probably benign 0.080 0.168 phenotype 05/24/2018
15 519213 UTSW Gm4951 0.000 R6446 G1 225.01 Y 18 60245768 D125G A G missense Het probably damaging 1.000 0.410 05/24/2018
16 519188 UTSW Grid2 0.000 R6446 G1 225.01 Y 6 64345593 I526F A T missense Het probably damaging 0.995 phenotype 05/24/2018
17 519186 UTSW Hectd4 0.424 R6446 G1 225.01 Y 5 121334375 Y2725N T A missense Het possibly damaging 0.861 0.360 05/24/2018
18 519185 UTSW Helq 0.000 R6446 G1 225.01 Y 5 100768384 N907K A T missense Het possibly damaging 0.638 0.065 phenotype 05/24/2018
19 519184 UTSW Hpse 0.000 R6446 G1 225.01 Y 5 100695569 Q246* G A nonsense Het probably null 0.604 phenotype 05/24/2018
20 519208 UTSW Kcnj15 0.000 R6446 G1 225.01 Y 16 95296259 H247Y C T missense Het probably benign 0.002 phenotype 05/24/2018
21 519201 UTSW Kif27 0.144 R6446 G1 225.01 Y 13 58345716 V138F C A missense Het probably damaging 1.000 phenotype 05/24/2018
22 519198 UTSW Map7 0.193 R6446 G1 225.01 Y 10 20278233 D698E T G missense Het unknown 0.094 phenotype 05/24/2018
23 519180 UTSW Mtmr11 0.298 R6446 G1 225.01 Y 3 96171188 S687C A T missense Het probably benign 0.001 05/24/2018
24 519206 UTSW Ncbp2 0.963 R6446 G1 217.47 Y 16 31956343 CGTCTGGATG CG frame shift Het probably null 0.648 phenotype 05/24/2018
25 519179 UTSW Nup210l 0.225 R6446 G1 225.01 Y 3 90172068 G953E G A missense Het probably damaging 1.000 phenotype 05/24/2018
26 519193 UTSW Olfr297 0.049 R6446 G1 225.01 Y 7 86527102 I115N T A missense Het possibly damaging 0.900 phenotype 05/24/2018
27 519214 UTSW Piezo2 1.000 R6446 G1 225.01 Y 18 63086607 P792T G T missense Het probably damaging 0.999 0.168 phenotype 05/24/2018
28 519189 UTSW Pld3 0.067 R6446 G1 225.01 Y 7 27537731 D241G T C missense Het probably damaging 1.000 0.464 phenotype 05/24/2018
29 519196 UTSW Prss35 0.187 R6446 G1 225.01 Y 9 86755653 V159F G T missense Het probably damaging 0.989 0.023 05/24/2018
30 519204 UTSW Rimbp3 0.297 R6446 G1 225.01 Y 16 17212929 M1406L A T missense Het probably benign 0.002 0.054 phenotype 05/24/2018
31 519200 UTSW Serpina3g 0.045 R6446 G1 225.01 Y 12 104239082 F27L T C missense Het probably damaging 1.000 0.358 phenotype 05/24/2018
32 519187 UTSW Setd1b 1.000 R6446 G1 225.01 Y 5 123161799 G A unclassified Het probably benign 0.168 phenotype 05/24/2018
33 519182 UTSW Sh3glb1 0.545 R6446 G1 225.01 Y 3 144705605 K13E T C missense Het probably damaging 0.996 0.206 phenotype 05/24/2018
34 519211 UTSW Slc29a1 0.000 R6446 G1 225.01 Y 17 45589245 I217N A T missense Het possibly damaging 0.878 0.210 phenotype 05/24/2018
35 519181 UTSW Spag17 0.490 R6446 G1 225.01 Y 3 100103132 T1981S A T missense Het probably benign 0.000 phenotype 05/24/2018
36 519212 UTSW Svil 0.368 R6446 G1 225.01 Y 18 5057323 E590D A C missense Het probably benign 0.087 phenotype 05/24/2018
37 519191 UTSW Synm 0.230 R6446 G1 225.01 Y 7 67734966 S541P A G missense Het probably damaging 1.000 0.140 phenotype 05/24/2018
38 519209 UTSW Vmn2r108 0.080 R6446 G1 225.01 Y 17 20472347 Y82* A T nonsense Het probably null 0.596 05/24/2018
[records 1 to 38 of 38]