Incidental Mutations

62 incidental mutations are currently displayed, and affect 62 genes.
13 are Possibly Damaging.
16 are Probably Damaging.
24 are Probably Benign.
7 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 62 of 62] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 528823 UTSW 1700020N01Rik 0.067 R6702 G1 225.01 Y 10 21621659 Y66* T A nonsense Het probably null 07/24/2018
2 528811 UTSW 2810474O19Rik 0.000 R6702 G1 225.01 Y 6 149327878 N807K T A missense Het probably damaging 0.981 0.088 07/24/2018
3 528840 UTSW Ak3 0.528 R6702 G1 225.01 Y 19 29026227 V183A A G missense Het probably damaging 1.000 phenotype 07/24/2018
4 528822 UTSW Ano10 0.135 R6702 G1 225.01 Y 9 122259564 Q397K G T missense Het possibly damaging 0.766 0.128 phenotype 07/24/2018
5 543536 UTSW Atg7 1.000 R6702 G1 221.01 Y 6 114671097 C A splice site Het probably null phenotype 02/22/2019
6 528835 UTSW Brpf3 0.879 R6702 G1 225.01 Y 17 28810659 N531T A C missense Het probably benign 0.013 phenotype 07/24/2018
7 528806 UTSW Casp2 0.278 R6702 G1 225.01 Y 6 42268051 V128A T C missense Het probably benign 0.000 0.008 phenotype 07/24/2018
8 528800 UTSW Cdcp2 0.080 R6702 G1 145.01 Y 4 107107086 C378R T C missense Het probably benign 0.000 0.115 07/24/2018
9 528825 UTSW Cfap54 0.111 R6702 G1 225.01 Y 10 92868734 D2828V T A missense Het unknown 0.054 phenotype 07/24/2018
10 528784 UTSW Col6a3 0.000 R6702 G1 225.01 Y 1 90779439 D1984G T C missense Het unknown phenotype 07/24/2018
11 528796 UTSW Csnk2a1 1.000 R6702 G1 225.01 Y 2 152258688 T93A A G missense Het probably benign 0.348 0.050 phenotype 07/24/2018
12 528802 UTSW Ddx54 1.000 R6702 G1 225.01 Y 5 120626503 D758E T A missense Het possibly damaging 0.516 phenotype 07/24/2018
13 528791 UTSW Dlx2 0.926 R6702 G1 180.01 Y 2 71546227 S56P A G missense Het probably damaging 0.998 phenotype 07/24/2018
14 528824 UTSW Dna2 1.000 R6702 G1 169.01 Y 10 62973294 I1055N T A missense Het possibly damaging 0.887 0.107 phenotype 07/24/2018
15 528803 UTSW Dnah10 0.160 R6702 G1 225.01 Y 5 124805805 Y2909C A G missense Het probably damaging 1.000 phenotype 07/24/2018
16 528786 UTSW Dnm3 0.000 R6702 G1 225.01 Y 1 162318687 F296L A G missense Het probably benign 0.040 phenotype 07/24/2018
17 528817 UTSW Fat1 1.000 R6702 G1 225.01 Y 8 44953046 T945A A G missense Het probably benign 0.276 phenotype 07/24/2018
18 528819 UTSW Herpud1 0.214 R6702 G1 225.01 Y 8 94392526 T C critical splice donor site 2 bp Het probably null 0.514 phenotype 07/24/2018
19 528805 UTSW Iqub 0.000 R6702 G1 225.01 Y 6 24449745 N707I T A missense Het probably damaging 1.000 0.472 07/24/2018
20 528788 UTSW Kif26b 1.000 R6702 G1 225.01 Y 1 178917287 S1649R C G missense Het possibly damaging 0.905 phenotype 07/24/2018
21 528794 UTSW Lamp5 0.000 R6702 G1 225.01 Y 2 136059563 N102K C G missense Het possibly damaging 0.507 0.058 07/24/2018
22 528808 UTSW Ltbr 0.211 R6702 G1 225.01 Y 6 125308068 S290P A G missense Het probably benign 0.005 0.012 phenotype 07/24/2018
23 528814 UTSW Map4k1 0.000 R6702 G1 134.01 Y 7 29002396 S803A T G missense Het possibly damaging 0.857 phenotype 07/24/2018
24 528831 UTSW Mef2c 1.000 R6702 G1 225.01 Y 13 83625406 C134S T A missense Het possibly damaging 0.696 phenotype 07/24/2018
25 528826 UTSW Myo15 0.000 R6702 G1 191.01 Y 11 60492992 I1622V A G missense Het probably benign 0.155 phenotype 07/24/2018
26 528798 UTSW Nbea 1.000 R6702 G1 225.01 Y 3 56005502 Y955H A G missense Het probably benign 0.061 phenotype 07/24/2018
27 528789 UTSW Ndor1 0.927 R6702 G1 225.01 Y 2 25249890 F142S A G missense Het possibly damaging 0.946 phenotype 07/24/2018
28 528833 UTSW Nynrin 0.000 R6702 G1 225.01 Y 14 55864478 T535A A G missense Het possibly damaging 0.795 0.016 07/24/2018
29 528793 UTSW Olfr1176 0.054 R6702 G1 225.01 Y 2 88340242 V226I G A missense Het probably benign 0.020 0.119 phenotype 07/24/2018
30 543535 UTSW Olfr1290 0.093 R6702 G1 225.01 Y 2 111490109 T A synonymous Het probably null 0.684 phenotype 02/22/2019
31 528834 UTSW Olfr205 0.080 R6702 G1 225.01 N 16 59328598 V304I C T missense Het probably benign 0.000 phenotype 07/24/2018
32 528832 UTSW Olfr727 0.095 R6702 G1 225.01 Y 14 50127231 Y218C A G missense Het probably damaging 1.000 0.590 phenotype 07/24/2018
33 528820 UTSW Olfr916 0.095 R6702 G1 225.01 Y 9 38657777 I205N A T missense Het possibly damaging 0.935 0.105 phenotype 07/24/2018
34 528839 UTSW Pcdhb13 0.073 R6702 G1 225.01 Y 18 37444775 H735Q T G missense Het probably benign 0.419 phenotype 07/24/2018
35 528838 UTSW Pcdhb7 0.062 R6702 G1 225.01 Y 18 37341906 M32L A T missense Het probably benign 0.027 07/24/2018
36 528804 UTSW Peg10 1.000 R6702 G1 217.47 N 6 4756452 GC GCTCC small insertion Het probably benign phenotype 07/24/2018
37 528785 UTSW Per2 0.261 R6702 G1 219.01 Y 1 91427949 E696K C T missense Het probably damaging 0.998 0.302 phenotype 07/24/2018
38 528829 UTSW Pld4 0.000 R6702 G1 225.01 Y 12 112765051 S213P T C missense Het probably damaging 0.999 phenotype 07/24/2018
39 528841 UTSW Prkg1 0.610 R6702 G1 225.01 Y 19 30993084 H209L T A missense Het probably benign 0.002 phenotype 07/24/2018
40 528812 UTSW Psg16 0.000 R6702 G1 225.01 Y 7 17090396 L35P T C missense Het probably damaging 0.998 07/24/2018
41 528801 UTSW Pxn 1.000 R6702 G1 184.01 Y 5 115551896 L160F C T missense Het probably benign 0.106 phenotype 07/24/2018
42 528818 UTSW Rab3a 0.472 R6702 G1 225.01 Y 8 70756448 D77G A G missense Het probably damaging 1.000 0.542 phenotype 07/24/2018
43 528815 UTSW Rgma 0.217 R6702 G1 225.01 Y 7 73417320 T108S A T missense Het probably damaging 1.000 0.426 phenotype 07/24/2018
44 528787 UTSW Rxrg 0.716 R6702 G1 225.01 Y 1 167613805 S51G A G missense Het probably benign 0.000 phenotype 07/24/2018
45 528830 UTSW S1pr3 0.000 R6702 G1 225.01 Y 13 51419439 I219F A T missense Het probably damaging 1.000 0.242 phenotype 07/24/2018
46 528795 UTSW Sec23b 1.000 R6702 G1 225.01 Y 2 144559189 A T intron Het probably null 0.640 phenotype 07/24/2018
47 528843 UTSW Sfrp5 0.000 R6702 G1 85.01 Y 19 42201827 T62K G T missense Het probably benign 0.016 phenotype 07/24/2018
48 528810 UTSW Slco1a6 0.071 R6702 G1 225.01 Y 6 142103100 Y318F T A missense Het probably damaging 0.994 0.166 07/24/2018
49 528842 UTSW Slit1 0.000 R6702 G1 202.01 Y 19 41614870 S931A A C missense Het possibly damaging 0.952 phenotype 07/24/2018
50 528821 UTSW Sorl1 0.539 R6702 G1 225.01 Y 9 42071201 V361E A T missense Het probably damaging 0.966 phenotype 07/24/2018
51 528828 UTSW St6galnac2 0.165 R6702 G1 225.01 Y 11 116684387 S209P A G missense Het probably benign 0.378 phenotype 07/24/2018
52 528827 UTSW Supt6 1.000 R6702 G1 225.01 Y 11 78231800 R199L C A missense Het possibly damaging 0.930 phenotype 07/24/2018
53 528809 UTSW Tas2r107 0.056 R6702 G1 225.01 Y 6 131659384 M234R A C missense Het probably benign 0.115 0.117 07/24/2018
54 528807 UTSW Tmem72 0.132 R6702 G1 225.01 Y 6 116698349 V61L C G missense Het probably benign 0.018 phenotype 07/24/2018
55 528816 UTSW Trpm5 0.129 R6702 G1 225.01 Y 7 143069318 C A unclassified Het probably benign phenotype 07/24/2018
56 528792 UTSW Ttn 1.000 R6702 G1 225.01 Y 2 76720112 T23282P T G missense Het probably damaging 0.971 0.272 phenotype 07/24/2018
57 528799 UTSW Ubap2 0.186 R6702 G1 217.47 Y 4 41227210 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT small insertion Het probably benign phenotype 07/24/2018
58 528790 UTSW Ubr3 1.000 R6702 G1 225.01 Y 2 69956049 R836W A T missense Het probably benign 0.232 phenotype 07/24/2018
59 528836 UTSW Umodl1 0.000 R6702 G1 225.01 Y 17 30986299 A G splice site 3 bp Het probably null 07/24/2018
60 528797 UTSW Ythdf1 0.000 R6702 G1 225.01 Y 2 180919133 A G critical splice donor site 2 bp Het probably null 0.746 07/24/2018
61 528813 UTSW Zfp780b 0.063 R6702 G1 225.01 N 7 27971641 T81A T C missense Het possibly damaging 0.907 07/24/2018
62 528837 UTSW Zfp811 0.065 R6702 G1 225.01 Y 17 32797842 E407G T C missense Het probably damaging 0.998 07/24/2018
[records 1 to 62 of 62]