Incidental Mutations

48 incidental mutations are currently displayed, and affect 48 genes.
8 are Possibly Damaging.
17 are Probably Damaging.
18 are Probably Benign.
5 are Probably Null.
2 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 48 of 48] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 533341 UTSW Adam3 0.000 R6801 G1 225.01 Y 8 24684664 Y695F T A missense Het possibly damaging 0.607 phenotype 09/12/2018
2 533345 UTSW Arhgap20 0.274 R6801 G1 225.01 Y 9 51848592 D545G A G missense Het probably damaging 1.000 phenotype 09/12/2018
3 533329 UTSW Arhgef11 0.000 R6801 G1 225.01 Y 3 87735852 E1457G A G missense Het possibly damaging 0.532 phenotype 09/12/2018
4 533316 UTSW Atp2b4 0.456 R6801 G1 225.01 Y 1 133727786 I747F T A missense Het probably damaging 0.967 0.254 phenotype 09/12/2018
5 533327 UTSW Bche 0.000 R6801 G1 225.01 Y 3 73701800 I98L T A missense Het probably benign 0.000 phenotype 09/12/2018
6 533314 UTSW C2cd6 0.050 R6801 G1 217.47 Y 1 59094583 TC T frame shift Het probably null 09/12/2018
7 533339 UTSW Ccdc90b 0.090 R6801 G1 225.01 Y 7 92567735 T72A A G missense Het probably benign 0.001 0.130 09/12/2018
8 533354 UTSW Chrd 1.000 R6801 G1 225.01 Y 16 20735747 E352G A G missense Het possibly damaging 0.679 phenotype 09/12/2018
9 533333 UTSW Csmd2 0.379 R6801 G1 225.01 Y 4 128383950 E953G A G missense Het probably benign 0.114 09/12/2018
10 533328 UTSW Dchs2 0.405 R6801 G1 129.01 Y 3 83128534 M196K T A missense Het probably benign 0.003 09/12/2018
11 533346 UTSW Ddx10 0.960 R6801 G1 225.01 Y 9 53247907 Q33* G A nonsense Het probably null 0.650 phenotype 09/12/2018
12 533330 UTSW Dennd4b 0.271 R6801 G1 225.01 Y 3 90268779 V201E T A missense Het probably damaging 0.975 09/12/2018
13 533358 UTSW Fbn2 0.838 R6801 G1 225.01 Y 18 58113348 H494L T A missense Het probably benign 0.039 phenotype 09/12/2018
14 533347 UTSW Fbxw13 0.057 R6801 G1 225.01 Y 9 109194727 A83V G A missense Het probably null 1.000 09/12/2018
15 533326 UTSW Fxr1 1.000 R6801 G1 225.01 Y 3 34054303 D321G A G missense Het possibly damaging 0.646 phenotype 09/12/2018
16 533357 UTSW Galm 0.096 R6801 G1 225.01 Y 17 80181624 H233R A G missense Het probably benign 0.009 0.074 phenotype 09/12/2018
17 533337 UTSW Gm7298 0.209 R6801 G1 120.01 Y 6 121775809 T837A A G missense Het probably benign 0.031 0.137 09/12/2018
18 533315 UTSW Gmppa 0.140 R6801 G1 225.01 Y 1 75441747 S258C C G missense Het possibly damaging 0.945 0.228 phenotype 09/12/2018
19 533348 UTSW Hk1 0.448 R6801 G1 225.01 Y 10 62281131 E645A T G missense Het probably damaging 0.966 phenotype 09/12/2018
20 533336 UTSW Igkv1-132 0.137 R6801 G1 225.01 Y 6 67760340 T97A A G missense Het probably damaging 0.991 09/12/2018
21 533338 UTSW Kcnc1 0.135 R6801 G1 225.01 Y 7 46435292 F547L T C missense Het probably damaging 0.986 phenotype 09/12/2018
22 533325 UTSW Lama5 1.000 R6801 G1 225.01 Y 2 180191662 P1519L G A missense Het probably damaging 1.000 0.200 phenotype 09/12/2018
23 533331 UTSW Lingo2 0.147 R6801 G1 225.01 Y 4 35709566 E138V T A missense Het probably damaging 0.973 09/12/2018
24 543647 UTSW Myb 1.000 R6801 G1 225.01 Y 10 21144966 T C splice site 3 bp Het probably null phenotype 04/22/2019
25 533312 UTSW Mybl1 0.540 R6801 G1 225.01 Y 1 9683128 V243A A G missense Het probably benign 0.421 phenotype 09/12/2018
26 533351 UTSW Mylk4 0.000 R6801 G1 225.01 Y 13 32728410 S189N C T missense Het probably benign 0.074 09/12/2018
27 533320 UTSW Olfr1133 0.060 R6801 G1 225.01 Y 2 87645323 Y267H A G missense Het probably benign 0.231 phenotype 09/12/2018
28 533321 UTSW Olfr1267-ps1 0.503 R6801 G1 225.01 Y 2 90085609 I284N A T missense Het probably damaging 1.000 09/12/2018
29 533323 UTSW Olfr1283 0.573 R6801 G1 225.01 Y 2 111369049 Q139L A T missense Het probably benign 0.216 phenotype 09/12/2018
30 533349 UTSW Olfr1388 0.078 R6801 G1 225.01 Y 11 49444342 M164V A G missense Het probably benign 0.103 phenotype 09/12/2018
31 533332 UTSW Olfr155 0.058 R6801 G1 225.01 Y 4 43855206 L299* T A nonsense Het probably null phenotype 09/12/2018
32 533342 UTSW Olfr27 0.058 R6801 G1 225.01 Y 9 39144210 I37F A T missense Het probably benign 0.014 phenotype 09/12/2018
33 533350 UTSW Oxld1 0.066 R6801 G1 225.01 Y 11 120456824 D182E A T missense Het probably damaging 1.000 0.112 09/12/2018
34 533334 UTSW Phf13 0.166 R6801 G1 225.01 Y 4 151991560 L295Q A T missense Het probably damaging 0.999 phenotype 09/12/2018
35 533317 UTSW Prrc2c 0.451 R6801 G1 217.47 Y 1 162709061 TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC unclassified Het probably benign 0.085 09/12/2018
36 533356 UTSW Prss33 0.057 R6801 G1 210.01 Y 17 23834839 L88P A G missense Het possibly damaging 0.878 0.069 09/12/2018
37 533319 UTSW Ralgds 0.175 R6801 G1 225.01 Y 2 28548436 Y596C A G missense Het probably damaging 1.000 0.410 phenotype 09/12/2018
38 533313 UTSW Rftn2 0.000 R6801 G1 201.01 Y 1 55194259 I379T A G missense Het possibly damaging 0.906 09/12/2018
39 533344 UTSW Rnf214 0.904 R6801 G1 225.01 Y 9 45896105 E267K C T missense Het probably damaging 0.999 09/12/2018
40 533353 UTSW Rpp14 0.930 R6801 G1 225.01 Y 14 8083717 T C start gained Het probably benign 0.111 09/12/2018
41 533324 UTSW Rpusd2 0.000 R6801 G1 225.01 Y 2 119035395 Y191C A G missense Het probably damaging 1.000 09/12/2018
42 533352 UTSW Serpinb9c 0.000 R6801 G1 225.01 Y 13 33157824 M1L T A start codon destroyed Het probably benign 0.005 09/12/2018
43 533335 UTSW Shroom3 1.000 R6801 G1 225.01 Y 5 92940936 D434G A G missense Het probably damaging 1.000 phenotype 09/12/2018
44 533359 UTSW Smc5 1.000 R6801 G1 225.01 Y 19 23214646 S888L G A missense Het probably benign 0.337 phenotype 09/12/2018
45 533318 UTSW Suv39h2 0.000 R6801 G1 225.01 Y 2 3464421 R299K C T missense Het probably benign 0.158 0.110 phenotype 09/12/2018
46 533343 UTSW Trappc4 0.960 R6801 G1 225.01 Y 9 44404388 I176N A T missense Het probably damaging 0.964 0.302 09/12/2018
47 533340 UTSW Trim12c 0.074 R6801 G1 225.01 Y 7 104348130 V73E A T missense Het probably damaging 1.000 0.244 09/12/2018
48 533355 UTSW Vmn2r111 0.099 R6801 G1 225.01 Y 17 22559051 N549S T C missense Het possibly damaging 0.502 0.068 09/12/2018
[records 1 to 48 of 48]