Incidental Mutations

55 incidental mutations are currently displayed, and affect 54 genes.
14 are Possibly Damaging.
17 are Probably Damaging.
21 are Probably Benign.
3 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 55 of 55] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 535605 UTSW 1700021F05Rik 0.327 R6850 G1 217.47 Y 10 43532725 ACTGCACCACCT ACT small deletion Het probably benign 09/12/2018
2 535606 UTSW 4932415D10Rik 0.192 R6850 G1 225.01 Y 10 82293054 M1374R A C missense Het possibly damaging 0.684 09/12/2018
3 535604 UTSW Adgb 0.000 R6850 G1 225.01 Y 10 10394574 M927V T C missense Het probably benign 0.394 09/12/2018
4 535612 UTSW Agr2 0.316 R6850 G1 225.01 Y 12 35995559 I15V A G missense Het probably benign 0.000 phenotype 09/12/2018
5 535585 UTSW Alpk1 0.117 R6850 G1 225.01 Y 3 127729363 I10T A G missense Het possibly damaging 0.865 phenotype 09/12/2018
6 535593 UTSW Art5 0.143 R6850 G1 225.01 Y 7 102098095 V159A A G missense Het possibly damaging 0.599 phenotype 09/12/2018
7 535591 UTSW Asz1 0.572 R6850 G1 225.01 Y 6 18108943 R32W G A missense Het probably benign 0.002 phenotype 09/12/2018
8 535622 UTSW Atp8b1 0.000 R6850 G1 225.01 Y 18 64556852 M603R A C missense Het possibly damaging 0.938 phenotype 09/12/2018
9 535574 UTSW Cacna1s 1.000 R6850 G1 225.01 Y 1 136092694 R823Q G A missense Het probably benign 0.015 phenotype 09/12/2018
10 535588 UTSW Car9 0.000 R6850 G1 225.01 Y 4 43507321 E3G A G missense Het probably damaging 0.964 phenotype 09/12/2018
11 535587 UTSW Cpne3 0.303 R6850 G1 225.01 Y 4 19535231 I267N A T missense Het possibly damaging 0.909 phenotype 09/12/2018
12 535625 UTSW Cyp2c65 0.039 R6850 G1 225.01 Y 19 39069091 F57I T A missense Het probably benign 0.152 09/12/2018
13 535580 UTSW D430041D05Rik 0.119 R6850 G1 225.01 Y 2 104201259 K980R T C missense Het probably damaging 1.000 09/12/2018
14 535594 UTSW Dnhd1 0.162 R6850 G1 225.01 Y 7 105719930 G4303W G T missense Het possibly damaging 0.680 09/12/2018
15 535611 UTSW Dnmt3a 0.695 R6850 G1 225.01 Y 12 3897600 N485D A G missense Het probably benign 0.395 phenotype 09/12/2018
16 535597 UTSW Dusp4 0.289 R6850 G1 225.01 Y 8 34816497 K166* A T nonsense Het probably null phenotype 09/12/2018
17 535581 UTSW Ect2 1.000 R6850 G1 225.01 Y 3 27138885 D344G T C missense Het probably damaging 0.999 phenotype 09/12/2018
18 535590 UTSW Eif2b1 0.985 R6850 G1 225.01 Y 5 124579006 D3G T C missense Het probably benign 0.146 phenotype 09/12/2018
19 535624 UTSW Ermp1 0.454 R6850 G1 225.01 Y 19 29616641 Y710H A G missense Het probably damaging 1.000 phenotype 09/12/2018
20 535586 UTSW Gar1 0.909 R6850 G1 225.01 Y 3 129829389 N117S T C missense Het probably damaging 0.999 09/12/2018
21 535598 UTSW Gm16486 0.223 R6850 G1 225.01 Y 8 70710776 N873Y A T missense Het probably damaging 0.974 09/12/2018
22 535619 UTSW Gm35339 0.259 R6850 G1 225.01 Y 15 76357796 Y763C A G missense Het probably damaging 0.997 09/12/2018
23 535620 UTSW H2-T10 0.131 R6850 G1 225.01 Y 17 36119260 L263P A G missense Het probably damaging 0.998 09/12/2018
24 535607 UTSW Itga7 0.675 R6850 G1 225.01 Y 10 128945516 I621F A T missense Het probably damaging 0.999 phenotype 09/12/2018
25 535584 UTSW Kcna3 0.063 R6850 G1 225.01 Y 3 107037159 D246V A T missense Het probably damaging 1.000 phenotype 09/12/2018
26 535616 UTSW Kctd12 0.572 R6850 G1 116.01 N 14 102981978 G155S C T missense Het probably benign 0.023 phenotype 09/12/2018
27 535614 UTSW Lrtm1 0.257 R6850 G1 225.01 Y 14 29027450 V256A T C missense Het probably benign 0.005 09/12/2018
28 535596 UTSW Mcf2l 0.288 R6850 G1 225.01 Y 8 13009476 F629L T C missense Het possibly damaging 0.821 phenotype 09/12/2018
29 535589 UTSW Mphosph9 0.481 R6850 G1 225.01 Y 5 124260956 F999L A G missense Het probably damaging 1.000 09/12/2018
30 535608 UTSW Obscn 0.731 R6850 G1 225.01 Y 11 59002129 A6764T C T missense Het possibly damaging 0.922 phenotype 09/12/2018
31 535609 UTSW Obscn 0.731 R6850 G1 225.01 Y 11 59068124 V3643M C T missense Het possibly damaging 0.933 phenotype 09/12/2018
32 535578 UTSW Olfr1189 0.188 R6850 G1 225.01 Y 2 88592306 C167* T A nonsense Het probably null phenotype 09/12/2018
33 535599 UTSW Olfr1537 0.099 R6850 G1 225.01 Y 9 39237975 I150V T C missense Het probably benign 0.013 phenotype 09/12/2018
34 535579 UTSW Pdhx 0.465 R6850 G1 225.01 Y 2 103041100 H195R T C missense Het probably damaging 0.999 phenotype 09/12/2018
35 535595 UTSW Pdilt 0.265 R6850 G1 225.01 Y 7 119486959 V511E A T missense Het probably damaging 0.979 phenotype 09/12/2018
36 535613 UTSW Prima1 0.000 R6850 G1 225.01 Y 12 103197335 D126N C T missense Het probably benign 0.414 phenotype 09/12/2018
37 535576 UTSW Prrc2c 0.370 R6850 G1 217.47 Y 1 162709061 TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC unclassified Het probably benign 09/12/2018
38 535623 UTSW Prune2 0.081 R6850 G1 225.01 Y 19 17122188 D1685E C A missense Het probably benign 0.001 phenotype 09/12/2018
39 535575 UTSW Ptgs2 0.497 R6850 G1 225.01 Y 1 150105540 I525F A T missense Het probably damaging 0.995 phenotype 09/12/2018
40 535627 UTSW Rab11fip2 0.139 R6850 G1 225.01 Y 19 59937009 F259I A T missense Het possibly damaging 0.580 09/12/2018
41 535617 UTSW Ranbp3l 0.153 R6850 G1 225.01 Y 15 9058727 D216E C A missense Het probably damaging 0.999 09/12/2018
42 535603 UTSW Scn5a 1.000 R6850 G1 225.01 Y 9 119501749 L1240Q A T missense Het possibly damaging 0.919 phenotype 09/12/2018
43 535582 UTSW Sohlh2 0.530 R6850 G1 225.01 Y 3 55192286 T160S A T missense Het probably benign 0.053 phenotype 09/12/2018
44 535626 UTSW Sorbs1 0.000 R6850 G1 225.01 Y 19 40376800 R180G G C missense Het probably benign 0.000 phenotype 09/12/2018
45 535577 UTSW Tank 0.407 R6850 G1 225.01 Y 2 61650002 E294G A G missense Het probably benign 0.190 phenotype 09/12/2018
46 535618 UTSW Tars 0.952 R6850 G1 225.01 Y 15 11392799 Y187F T A missense Het probably benign 0.000 phenotype 09/12/2018
47 535592 UTSW Tas2r144 0.059 R6850 G1 225.01 Y 6 42215923 M199K T A missense Het possibly damaging 0.713 09/12/2018
48 535615 UTSW Tdrd3 0.332 R6850 G1 225.01 Y 14 87458079 T C intron Het probably benign phenotype 09/12/2018
49 535600 UTSW Tecta 0.166 R6850 G1 225.01 Y 9 42343838 D1683V T A missense Het probably benign 0.202 phenotype 09/12/2018
50 535601 UTSW Tln2 0.400 R6850 G1 225.01 Y 9 67258535 I2098T A G missense Het probably damaging 1.000 phenotype 09/12/2018
51 535602 UTSW Tmie 0.090 R6850 G1 225.01 Y 9 110866912 I137T A G missense Het possibly damaging 0.675 phenotype 09/12/2018
52 535583 UTSW Trim45 0.186 R6850 G1 225.01 Y 3 100923225 L105* T A nonsense Het probably null phenotype 09/12/2018
53 535610 UTSW Trpv3 0.135 R6850 G1 225.01 Y 11 73291693 G568S G A missense Het probably damaging 1.000 0.290 phenotype 09/12/2018
54 535573 UTSW Wdr75 0.963 R6850 G1 225.01 Y 1 45814598 T390A A G missense Het probably benign 0.005 09/12/2018
55 535621 UTSW Zfp35 0.501 R6850 G1 225.01 Y 18 24002782 R61H G A missense Het possibly damaging 0.759 phenotype 09/12/2018
[records 1 to 55 of 55]