Incidental Mutations

63 incidental mutations are currently displayed, and affect 63 genes.
11 are Possibly Damaging.
23 are Probably Damaging.
20 are Probably Benign.
6 are Probably Null.
1 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 63 of 63] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 536790 UTSW Abca16 0.000 R6885 G1 225.01 Y 7 120520109 I1025M A G missense Het probably benign 0.066 10/18/2018
2 536798 UTSW Adamtsl5 0.000 R6885 G1 215.01 N 10 80343631 T164S T A missense Het probably benign 0.010 10/18/2018
3 536762 UTSW Ankar 0.063 R6885 G1 225.01 Y 1 72643036 A1239T C T missense Het unknown 10/18/2018
4 536761 UTSW Aox4 0.000 R6885 G1 225.01 Y 1 58264378 S1192C A T missense Het probably damaging 1.000 phenotype 10/18/2018
5 536818 UTSW Atl2 1.000 R6885 G1 225.01 Y 17 79852553 D68G T C missense Het probably damaging 1.000 10/18/2018
6 536816 UTSW Btnl4 0.000 R6885 G1 225.01 Y 17 34472945 I228V T C missense Het probably benign 0.003 10/18/2018
7 536775 UTSW Catsper4 0.000 R6885 G1 225.01 Y 4 134215149 T231A T C missense Het probably benign 0.002 phenotype 10/18/2018
8 536806 UTSW Ccl12 0.000 R6885 G1 225.01 Y 11 82102697 T54S A T missense Het probably damaging 0.957 0.018 phenotype 10/18/2018
9 536811 UTSW Cntn1 1.000 R6885 G1 225.01 Y 15 92243099 T C critical splice donor site 2 bp Het probably null phenotype 10/18/2018
10 536808 UTSW Cog5 0.890 R6885 G1 225.01 Y 12 31894199 D694E T A missense Het probably damaging 1.000 0.230 phenotype 10/18/2018
11 536764 UTSW Crat 0.212 R6885 G1 225.01 Y 2 30415196 T A splice site Het probably benign phenotype 10/18/2018
12 536777 UTSW Crot 0.114 R6885 G1 225.01 Y 5 8973635 T418A T C missense Het probably benign 0.005 phenotype 10/18/2018
13 536763 UTSW Cubn 1.000 R6885 G1 225.01 Y 2 13318278 P2826L G A missense Het probably damaging 0.998 phenotype 10/18/2018
14 536807 UTSW Dnah17 0.000 R6885 G1 225.01 Y 11 118090772 F1698L A G missense Het possibly damaging 0.469 phenotype 10/18/2018
15 536822 UTSW Dock8 0.095 R6885 G1 225.01 Y 19 25147378 D1019E T A missense Het possibly damaging 0.955 phenotype 10/18/2018
16 536773 UTSW Eps15 0.000 R6885 G1 225.01 Y 4 109309164 N85D A G missense Het probably damaging 0.990 phenotype 10/18/2018
17 536781 UTSW Exoc1 1.000 R6885 G1 225.01 Y 5 76559042 S457P T C missense Het probably damaging 1.000 phenotype 10/18/2018
18 536810 UTSW Ext1 1.000 R6885 G1 225.01 Y 15 53101692 T426I G A missense Het probably damaging 1.000 phenotype 10/18/2018
19 536792 UTSW Fat1 1.000 R6885 G1 225.01 Y 8 44952452 S747P T C missense Het possibly damaging 0.936 phenotype 10/18/2018
20 536802 UTSW Gas7 0.000 R6885 G1 225.01 Y 11 67683387 D396G A G missense Het probably damaging 0.992 0.224 phenotype 10/18/2018
21 536776 UTSW Gm13023 0.091 R6885 G1 225.01 Y 4 143793533 C116R T C missense Het probably damaging 1.000 10/18/2018
22 536789 UTSW Gm5114 0.065 R6885 G1 225.01 N 7 39408156 R680S G T missense Het probably benign 0.006 10/18/2018
23 536767 UTSW Gpcpd1 0.923 R6885 G1 225.01 Y 2 132554074 L94M A T missense Het possibly damaging 0.556 0.114 10/18/2018
24 536793 UTSW Gse1 0.188 R6885 G1 137.01 Y 8 120229482 C A intron Het probably benign 10/18/2018
25 536784 UTSW Hmgb1 0.939 R6885 G1 206.01 Y 5 149050661 E26G T C missense Het probably benign 0.327 phenotype 10/18/2018
26 536821 UTSW Incenp 1.000 R6885 G1 225.01 N 19 9875132 R714Q C T missense Het unknown phenotype 10/18/2018
27 536812 UTSW Krt73 0.113 R6885 G1 225.01 Y 15 101796398 E351G T C missense Het probably damaging 0.997 0.380 phenotype 10/18/2018
28 536805 UTSW Ksr1 0.176 R6885 G1 222.01 Y 11 79047295 A G critical splice donor site 2 bp Het probably null 0.656 phenotype 10/18/2018
29 536817 UTSW Lpin2 0.302 R6885 G1 225.01 Y 17 71215150 S60A T G missense Het probably damaging 1.000 phenotype 10/18/2018
30 536771 UTSW Lrrc71 0.000 R6885 G1 225.01 Y 3 87742620 T C splice site 4 bp Het probably null 10/18/2018
31 536768 UTSW Mafb 0.721 R6885 G1 225.01 Y 2 160366019 S220P A G missense Het possibly damaging 0.808 phenotype 10/18/2018
32 540707 UTSW Maml3 0.000 R6885 G1 109.47 N 3 51697579 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC Het phenotype 11/16/2018
33 536791 UTSW Mcmbp 1.000 R6885 G1 225.01 Y 7 128725109 T C splice site 4 bp Het probably null phenotype 10/18/2018
34 536765 UTSW Olfr1191-ps1 0.096 R6885 G1 225.01 Y 2 88643597 T277A A G missense Het probably damaging 0.963 10/18/2018
35 536803 UTSW Olfr390 0.089 R6885 G1 225.01 Y 11 73787100 H54L A T missense Het possibly damaging 0.944 0.196 phenotype 10/18/2018
36 536795 UTSW Paqr9 0.076 R6885 G1 100.01 N 9 95560043 S29P T C missense Het probably benign 0.002 10/18/2018
37 536782 UTSW Parm1 0.097 R6885 G1 225.01 Y 5 91594210 T146A A G missense Het possibly damaging 0.707 10/18/2018
38 536780 UTSW Pgm1 0.000 R6885 G1 225.01 Y 5 64103878 F238L T A missense Het probably benign 0.004 0.068 phenotype 10/18/2018
39 536774 UTSW Pigv 0.748 R6885 G1 225.01 Y 4 133665481 F126Y A T missense Het probably damaging 0.990 phenotype 10/18/2018
40 536772 UTSW Pitx2 1.000 R6885 G1 225.01 Y 3 129218608 M222T T C missense Het probably damaging 0.999 phenotype 10/18/2018
41 536788 UTSW Plekhg6 0.070 R6885 G1 225.01 Y 6 125378730 N37S T C missense Het probably benign 0.000 10/18/2018
42 536800 UTSW Psme4 0.000 R6885 G1 225.01 Y 11 30834307 K961* A T nonsense Het probably null phenotype 10/18/2018
43 536779 UTSW Rbpj 1.000 R6885 G1 225.01 Y 5 53653151 W392R T C missense Het probably damaging 1.000 phenotype 10/18/2018
44 536787 UTSW Reg3a 0.050 R6885 G1 225.01 Y 6 78381055 T A intron Het probably null 10/18/2018
45 536785 UTSW Rfc3 0.970 R6885 G1 225.01 Y 5 151648284 S85N C T missense Het probably benign 0.004 phenotype 10/18/2018
46 536820 UTSW Rtn3 0.201 R6885 G1 225.01 Y 19 7458331 T80A T C missense Het probably benign 0.308 0.016 phenotype 10/18/2018
47 536797 UTSW Sash1 1.000 R6885 G1 225.01 Y 10 8784221 T195A T C missense Het probably damaging 0.996 phenotype 10/18/2018
48 536819 UTSW Ska1 0.930 R6885 G1 225.01 Y 18 74206839 V12A A G missense Het probably benign 0.415 phenotype 10/18/2018
49 536813 UTSW Slc25a1 1.000 R6885 G1 225.01 Y 16 17927430 V80A A G missense Het probably benign 0.001 10/18/2018
50 536778 UTSW Slc26a5 0.000 R6885 G1 225.01 Y 5 21834344 V217D A T missense Het probably damaging 0.997 phenotype 10/18/2018
51 536804 UTSW Slc46a1 0.000 R6885 G1 225.01 Y 11 78466979 D286G A G missense Het probably benign 0.039 0.092 phenotype 10/18/2018
52 536794 UTSW Spata2l 0.077 R6885 G1 225.01 Y 8 123235558 L88Q A T missense Het probably damaging 1.000 10/18/2018
53 536799 UTSW Sptbn1 1.000 R6885 G1 225.01 Y 11 30138634 Q876P T G missense Het probably benign 0.260 0.052 phenotype 10/18/2018
54 536801 UTSW Tenm2 0.763 R6885 G1 225.01 Y 11 36023580 I2377F T A missense Het possibly damaging 0.946 0.134 phenotype 10/18/2018
55 536809 UTSW Thbs4 0.000 R6885 G1 225.01 Y 13 92762869 D539E A T missense Het probably damaging 0.963 0.224 phenotype 10/18/2018
56 536770 UTSW Tmem154 0.023 R6885 G1 225.01 Y 3 84692506 C162S T A missense Het possibly damaging 0.953 10/18/2018
57 536783 UTSW Tpcn1 0.000 R6885 G1 225.01 Y 5 120544437 E502G T C missense Het probably benign 0.213 phenotype 10/18/2018
58 536815 UTSW Traf7 0.566 R6885 G1 225.01 Y 17 24512292 R257C G A missense Het probably benign 0.279 0.208 phenotype 10/18/2018
59 536769 UTSW Tsc22d2 0.601 R6885 G1 225.01 Y 3 58416208 Y174H T C missense Het probably damaging 0.998 10/18/2018
60 536766 UTSW Usp8 1.000 R6885 G1 225.01 Y 2 126752310 E802G A G missense Het probably damaging 1.000 0.366 phenotype 10/18/2018
61 536786 UTSW Vmn1r5 0.061 R6885 G1 225.01 N 6 56986057 V239A T C missense Het possibly damaging 0.886 10/18/2018
62 536814 UTSW Vmn2r99 0.138 R6885 G1 225.01 Y 17 19380195 S494T T A missense Het possibly damaging 0.524 10/18/2018
63 536796 UTSW Zbtb38 0.492 R6885 G1 225.01 Y 9 96686464 F856L A G missense Het probably damaging 0.998 phenotype 10/18/2018
[records 1 to 63 of 63]