Incidental Mutations

78 incidental mutations are currently displayed, and affect 78 genes.
10 are Possibly Damaging.
27 are Probably Damaging.
30 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
3 are critical splice junction mutations.
Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 78 of 78] per page Full List
 
 ID question?
 Source question?
 Gene question?
 E-score question?
  		Stock # question?
 Gen question?
 Quality
- 		Vld question?
 Strain question?
 Chr question?
 Position question?
 		 Mutation question?
 Ref
 Var
 Type question?
 Exon Dist question?
  		Zygosity question?
 Predicted Effect question?
 PPH Score question?
- 		Meta Score question?
  		MGI Phenotype question?
 Posted question?
 
1 541534 UTSW 2210016F16Rik 0.097 R6957 G1 225.01 N 13 58381961 C279F C A missense Het probably damaging 1.000 11/28/2018
2 541485 UTSW 2310009B15Rik 0.054 R6957 G1 225.01 N 1 138852119 S132P A G missense Het probably damaging 1.000 11/28/2018
3 541523 UTSW 4932415D10Rik 0.148 R6957 G1 225.01 N 10 82293786 I1130K A T missense Het probably benign 0.026 11/28/2018
4 541531 UTSW Abcb5 0.235 R6957 G1 225.01 N 12 118907535 F710L A G missense Het probably damaging 0.999 phenotype 11/28/2018
5 541511 UTSW Acsm4 0.095 R6957 G1 225.01 N 7 119711399 V503G T G missense Het probably damaging 0.999 11/28/2018
6 541513 UTSW Adam26a 0.059 R6957 G1 225.01 N 8 43568903 M517L T A missense Het probably benign 0.003 phenotype 11/28/2018
7 541486 UTSW Adcy10 0.228 R6957 G1 225.01 N 1 165564285 L1345I C A missense Het probably damaging 1.000 phenotype 11/28/2018
8 541535 UTSW Adgrv1 0.000 R6957 G1 225.01 N 13 81567490 I860V T C missense Het probably benign 0.002 phenotype 11/28/2018
9 541550 UTSW Alcam 0.221 R6957 G1 225.01 N 16 52276894 D333G T C missense Het probably damaging 1.000 phenotype 11/28/2018
10 541521 UTSW Amt 1.000 R6957 G1 225.01 N 9 108299833 F213L C A missense Het possibly damaging 0.511 phenotype 11/28/2018
11 541522 UTSW Ascc3 0.968 R6957 G1 225.01 N 10 50728182 T1333A A G missense Het probably damaging 1.000 phenotype 11/28/2018
12 541556 UTSW Asxl3 0.540 R6957 G1 225.01 N 18 22522091 L1053I C A missense Het probably damaging 1.000 11/28/2018
13 541545 UTSW Atxn10 1.000 R6957 G1 225.01 N 15 85336498 S12P T C missense Het probably damaging 0.997 phenotype 11/28/2018
14 541548 UTSW AU021092 0.083 R6957 G1 225.01 N 16 5212153 I333V T C missense Het probably benign 0.034 phenotype 11/28/2018
15 541554 UTSW Birc6 1.000 R6957 G1 225.01 N 17 74579491 I577V A G missense Het probably benign 0.000 phenotype 11/28/2018
16 541552 UTSW Cadm2 0.352 R6957 G1 225.01 N 16 66812838 F132I A T missense Het probably benign 0.019 phenotype 11/28/2018
17 541514 UTSW Casp3 1.000 R6957 G1 225.01 N 8 46634273 V85D T A missense Het probably damaging 1.000 phenotype 11/28/2018
18 541526 UTSW Ccdc85a 0.276 R6957 G1 225.01 N 11 28392944 A T intron Het probably benign 11/28/2018
19 541509 UTSW Cd22 0.000 R6957 G1 225.01 N 7 30867574 R760G T C missense Het possibly damaging 0.880 phenotype 11/28/2018
20 541499 UTSW Cela3a 0.088 R6957 G1 225.01 N 4 137408130 W41R A T missense Het probably damaging 1.000 phenotype 11/28/2018
21 541519 UTSW Cep164 0.459 R6957 G1 225.01 N 9 45772280 A G critical splice donor site 2 bp Het probably null phenotype 11/28/2018
22 541484 UTSW Cntnap5b 0.075 R6957 G1 225.01 N 1 100274472 E348G A G missense Het probably benign 0.080 11/28/2018
23 541495 UTSW Ddx20 1.000 R6957 G1 225.01 N 3 105684310 K181N C A missense Het probably benign 0.303 phenotype 11/28/2018
24 541487 UTSW Dnah14 0.075 R6957 G1 225.01 N 1 181785175 A3846P G C missense Het possibly damaging 0.918 phenotype 11/28/2018
25 541528 UTSW Ern1 1.000 R6957 G1 225.01 N 11 106403539 I813S A C missense Het probably damaging 0.999 phenotype 11/28/2018
26 541529 UTSW Fam181a 0.239 R6957 G1 225.01 N 12 103316514 G226D G A missense Het probably damaging 0.969 11/28/2018
27 541546 UTSW Fam186a 0.147 R6957 G1 225.01 N 15 99946476 D629V T A missense Het unknown 11/28/2018
28 541542 UTSW Fam84b 0.125 R6957 G1 170.01 N 15 60823085 T271A T C missense Het probably benign 0.000 11/28/2018
29 541508 UTSW Gipr 0.180 R6957 G1 225.01 N 7 19164604 T26S T A missense Het probably benign 0.015 phenotype 11/28/2018
30 541536 UTSW Gm3159 0.070 R6957 G1 185.01 N 14 4398530 R74G A G missense Het possibly damaging 0.944 11/28/2018
31 541483 UTSW Gm8251 0.170 R6957 G1 225.01 N 1 44057207 C1577Y C T missense Het probably benign 0.003 11/28/2018
32 541555 UTSW Greb1l 0.616 R6957 G1 225.01 N 18 10558786 V1814I G A missense Het probably benign 0.227 11/28/2018
33 541488 UTSW Hacd1 0.319 R6957 G1 225.01 N 2 14044853 V98E A T missense Het probably damaging 1.000 phenotype 11/28/2018
34 541533 UTSW Iars 1.000 R6957 G1 225.01 N 13 49722161 F775V T G missense Het probably damaging 0.998 phenotype 11/28/2018
35 541505 UTSW Il12rb2 0.000 R6957 G1 225.01 N 6 67292652 L726F G A missense Het possibly damaging 0.600 phenotype 11/28/2018
36 541538 UTSW Itih4 0.000 R6957 G1 225.01 N 14 30892603 V474A T C missense Het probably damaging 1.000 phenotype 11/28/2018
37 541518 UTSW Kmt2a 1.000 R6957 G1 225.01 N 9 44820022 A C unclassified Het probably benign phenotype 11/28/2018
38 541540 UTSW Ktn1 0.000 R6957 G1 225.01 N 14 47667353 L196* T A nonsense Het probably null phenotype 11/28/2018
39 541559 UTSW Lipo4 0.111 R6957 G1 225.01 N 19 33499367 V327A A G missense Het probably benign 0.298 11/28/2018
40 541539 UTSW Lrit1 0.118 R6957 G1 225.01 N 14 37060095 V242L G C missense Het probably damaging 0.992 phenotype 11/28/2018
41 541492 UTSW Lrp4 0.620 R6957 G1 225.01 N 2 91487042 T837K C A missense Het probably damaging 0.994 phenotype 11/28/2018
42 541504 UTSW Mad1l1 1.000 R6957 G1 225.01 N 5 140065817 F664L G T missense Het probably damaging 0.989 phenotype 11/28/2018
43 541498 UTSW Mecr 0.609 R6957 G1 225.01 N 4 131861861 T247A A G missense Het probably benign 0.001 11/28/2018
44 541503 UTSW Msi1 0.423 R6957 G1 225.01 N 5 115445424 A228T G A missense Het probably benign 0.037 phenotype 11/28/2018
45 541497 UTSW Mup5 0.118 R6957 G1 225.01 N 4 61833036 N125I T A missense Het probably damaging 1.000 11/28/2018
46 541493 UTSW Mybl2 1.000 R6957 G1 190.01 N 2 163072808 S282F C T missense Het possibly damaging 0.858 phenotype 11/28/2018
47 541512 UTSW Myom2 0.222 R6957 G1 225.01 N 8 15117741 A1109T G A missense Het probably null 0.420 phenotype 11/28/2018
48 541541 UTSW Nalcn 1.000 R6957 G1 225.01 N 14 123507554 D354G T C missense Het probably damaging 0.958 phenotype 11/28/2018
49 541547 UTSW Nckap1l 0.662 R6957 G1 225.01 N 15 103491511 V1040A T C missense Het possibly damaging 0.910 phenotype 11/28/2018
50 541506 UTSW Nlrp12 0.088 R6957 G1 225.01 N 7 3222486 D1051V T A missense Het probably damaging 0.995 phenotype 11/28/2018
51 541516 UTSW Nudt7 0.055 R6957 G1 225.01 N 8 114133645 K16R A G missense Het probably benign 0.026 phenotype 11/28/2018
52 541491 UTSW Olfr1270 0.116 R6957 G1 225.01 N 2 90149150 Y285* G T nonsense Het probably null phenotype 11/28/2018
53 541517 UTSW Olfr947-ps1 R6957 G1 225.01 N 9 39289281 V203A A G missense Het unknown 11/28/2018
54 541501 UTSW Paqr3 0.171 R6957 G1 225.01 N 5 97108251 I88K A T missense Het possibly damaging 0.478 phenotype 11/28/2018
55 541549 UTSW Parp9 0.197 R6957 G1 225.01 N 16 35948346 M299V A G missense Het probably benign 0.004 11/28/2018
56 541494 UTSW Pde4dip 1.000 R6957 G1 225.01 N 3 97824333 A T splice site Het probably null phenotype 11/28/2018
57 541525 UTSW Pex13 1.000 R6957 G1 225.01 N 11 23655628 M201L T G missense Het probably benign 0.000 phenotype 11/28/2018
58 541527 UTSW Pfas 1.000 R6957 G1 225.01 N 11 68993883 V498L C A missense Het probably benign 0.138 phenotype 11/28/2018
59 541560 UTSW Phka2 0.183 R6957 G1 222 N X 160533048 V230I G A missense Het probably damaging 0.992 phenotype 11/28/2018
60 541543 UTSW Plec 0.862 R6957 G1 225.01 N 15 76186214 D932V T A missense Het probably damaging 1.000 phenotype 11/28/2018
61 541489 UTSW Qsox2 0.102 R6957 G1 225.01 N 2 26217642 A445T C T missense Het probably benign 0.401 phenotype 11/28/2018
62 541490 UTSW Rapgef1 1.000 R6957 G1 225.01 N 2 29733698 Q820K C A missense Het possibly damaging 0.615 phenotype 11/28/2018
63 541496 UTSW Samd13 0.160 R6957 G1 225.01 N 3 146662669 A G critical splice donor site 2 bp Het probably null 11/28/2018
64 541544 UTSW Samm50 0.936 R6957 G1 225.01 N 15 84198649 D104Y G T missense Het probably damaging 1.000 phenotype 11/28/2018
65 541507 UTSW Sbk3 0.109 R6957 G1 225.01 N 7 4967523 F282L A T missense Het probably benign 0.000 11/28/2018
66 541537 UTSW Sfmbt1 0.364 R6957 G1 225.01 N 14 30787589 H342Y C T missense Het probably benign 0.002 phenotype 11/28/2018
67 541515 UTSW Sgo2b 0.180 R6957 G1 120.47 N 8 63931455 CCATCATCATCATCATCATCAT CCATCATCATCATCATCAT small deletion Het probably benign 11/28/2018
68 541557 UTSW Slc12a2 0.000 R6957 G1 225.01 N 18 57910272 L596* T A nonsense Het probably null phenotype 11/28/2018
69 541558 UTSW St8sia3 0.256 R6957 G1 225.01 N 18 64271782 S377P T C missense Het probably benign 0.252 phenotype 11/28/2018
70 541532 UTSW Stmnd1 0.140 R6957 G1 225.01 N 13 46273899 S28A T G missense Het probably benign 0.090 11/28/2018
71 541530 UTSW Syne3 0.113 R6957 G1 225.01 N 12 104954302 L458Q A T missense Het probably damaging 0.998 11/28/2018
72 541510 UTSW Synm 0.207 R6957 G1 225.01 N 7 67736100 V163I C T missense Het probably benign 0.278 phenotype 11/28/2018
73 541551 UTSW Tbc1d23 0.666 R6957 G1 225.01 N 16 57208323 C161R A G missense Het probably damaging 1.000 phenotype 11/28/2018
74 541500 UTSW Tnfrsf4 0.025 R6957 G1 225.01 N 4 156016168 V215I G A missense Het probably benign 0.001 phenotype 11/28/2018
75 541553 UTSW Vars2 0.958 R6957 G1 225.01 N 17 35667075 K67Q T G missense Het probably benign 0.391 phenotype 11/28/2018
76 541502 UTSW Vmn2r13 0.139 R6957 G1 225.01 N 5 109156887 Y559* A T nonsense Het probably null 11/28/2018
77 541524 UTSW Wdpcp 0.389 R6957 G1 225.01 N 11 21721154 I465T T C missense Het possibly damaging 0.941 phenotype 11/28/2018
78 541520 UTSW Zwilch 0.591 R6957 G1 225.01 N 9 64162562 A C critical splice donor site 2 bp Het probably null 11/28/2018
[records 1 to 78 of 78]