Incidental Mutations

89 incidental mutations are currently displayed, and affect 87 genes.
14 are Possibly Damaging.
22 are Probably Damaging.
42 are Probably Benign.
11 are Probably Null.
2 create premature stop codons.
6 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 89 of 89] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 543733 UTSW Abca2 0.000 R6980 G1 225.01 N 2 25440866 R1189S C A missense Het possibly damaging 0.889 phenotype 05/13/2019
2 543759 UTSW Abcf2 0.246 R6980 G1 225.01 N 5 24565972 Q594R T C missense Het probably benign 0.006 phenotype 05/13/2019
3 543742 UTSW Abhd18 0.099 R6980 G1 225.01 N 3 40933780 S353N G A missense Het probably benign 0.000 05/13/2019
4 543815 UTSW Adrb1 0.524 R6980 G1 225.01 N 19 56723614 A415S G T missense Het probably benign 0.273 phenotype 05/13/2019
5 543773 UTSW Art2b 0.055 R6980 G1 225.01 N 7 101580473 N73S T C missense Het probably benign 0.009 05/13/2019
6 543745 UTSW BC028528 0.073 R6980 G1 214.46 N 3 95888136 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT small insertion Het probably benign 05/13/2019
7 543746 UTSW BC028528 0.073 R6980 G1 217.47 N 3 95888139 ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCTCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC small insertion Het probably benign 05/13/2019
8 543747 UTSW BC028528 0.073 R6980 G1 217.47 N 3 95888168 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT small insertion Het probably benign 05/13/2019
9 543776 UTSW Cacna1a 0.927 R6980 G1 225.01 N 8 84612285 M1753V A G missense Het possibly damaging 0.848 phenotype 05/13/2019
10 543787 UTSW Cbx8 0.000 R6980 G1 225.01 N 11 119039461 I102N A T missense Het possibly damaging 0.733 phenotype 05/13/2019
11 543807 UTSW Ccdc178 0.000 R6980 G1 225.01 N 18 22105563 E332D T A missense Het probably benign 0.000 05/13/2019
12 543756 UTSW Cfap74 0.000 R6980 G1 225.01 N 4 155466352 G A unclassified Het probably benign 05/13/2019
13 543797 UTSW Chat 0.461 R6980 G1 206.01 N 14 32424154 M354K A T missense Het probably benign 0.149 phenotype 05/13/2019
14 543768 UTSW Cmas 0.714 R6980 G1 118.01 N 6 142756800 T10A A G missense Het probably damaging 0.966 phenotype 05/13/2019
15 543748 UTSW Cyb561d1 0.069 R6980 G1 225.01 N 3 108200159 L51H A T missense Het probably benign 0.016 05/13/2019
16 543812 UTSW D030056L22Rik R6980 G1 145.01 N 19 18717265 N128I A T missense Het probably damaging 0.979 05/13/2019
17 543789 UTSW D130043K22Rik 0.000 R6980 G1 225.01 N 13 24864781 A423S G T missense Het probably damaging 0.983 phenotype 05/13/2019
18 543732 UTSW Dnah14 0.071 R6980 G1 225.01 N 1 181648230 I1349T T C missense Het probably benign 0.004 phenotype 05/13/2019
19 543728 UTSW Dnajb3 0.000 R6980 G1 225.01 N 1 88205014 D222A T G missense Het probably damaging 1.000 05/13/2019
20 543764 UTSW Dtx1 0.000 R6980 G1 225.01 N 5 120681357 E592G T C missense Het probably damaging 1.000 phenotype 05/13/2019
21 543741 UTSW Dzank1 0.000 R6980 G1 225.01 N 2 144490136 G427R C T missense Het possibly damaging 0.874 phenotype 05/13/2019
22 543751 UTSW E130308A19Rik 0.148 R6980 G1 225.01 N 4 59719991 K508Q A C missense Het probably damaging 0.969 05/13/2019
23 543790 UTSW Eif4e1b 0.000 R6980 G1 225.01 N 13 54784103 T A critical splice donor site 2 bp Het probably null 05/13/2019
24 543793 UTSW Ell2 0.000 R6980 G1 225.01 N 13 75756376 M159V A G missense Het probably null 0.000 05/13/2019
25 543806 UTSW Eml4 0.799 R6980 G1 225.01 N 17 83451017 V377I G A missense Het probably benign 0.002 phenotype 05/13/2019
26 543761 UTSW Fryl 0.916 R6980 G1 225.01 N 5 73050430 S2466T A T missense Het probably benign 0.063 phenotype 05/13/2019
27 543767 UTSW Gfpt1 1.000 R6980 G1 225.01 N 6 87077089 T426K C A missense Het probably damaging 0.998 phenotype 05/13/2019
28 543757 UTSW Gm28710 0.254 R6980 G1 225.01 N 5 16826946 V533D T A missense Het possibly damaging 0.918 05/13/2019
29 543795 UTSW Gm49355 R6980 G1 225.01 N 14 12307173 T C unclassified Het probably benign 05/13/2019
30 543770 UTSW Gm5114 0.065 R6980 G1 225.01 N 7 39409200 I332V T C missense Het probably benign 0.006 05/13/2019
31 543802 UTSW Gpr15 0.000 R6980 G1 225.01 N 16 58718742 T A start gained Het probably benign phenotype 05/13/2019
32 543784 UTSW Gpr179 0.069 R6980 G1 225.01 N 11 97334858 E2157G T C missense Het probably benign 0.375 phenotype 05/13/2019
33 543799 UTSW Gramd4 0.000 R6980 G1 225.01 N 15 86131969 N482S A G missense Het probably benign 0.166 phenotype 05/13/2019
34 543763 UTSW Hfm1 0.115 R6980 G1 225.01 N 5 106880477 I829K A T missense Het probably benign 0.311 phenotype 05/13/2019
35 543777 UTSW Hydin 0.728 R6980 G1 225.01 N 8 110413284 E728D A T missense Het possibly damaging 0.907 phenotype 05/13/2019
36 543803 UTSW Ifngr2 0.000 R6980 G1 225.01 N 16 91560007 V143E T A missense Het probably damaging 1.000 phenotype 05/13/2019
37 543760 UTSW Ift172 1.000 R6980 G1 225.01 N 5 31257386 D1390G T C missense Het probably benign 0.000 phenotype 05/13/2019
38 543755 UTSW Kdf1 1.000 R6980 G1 225.01 N 4 133528827 D285V A T missense Het probably damaging 1.000 phenotype 05/13/2019
39 543794 UTSW Mast4 0.489 R6980 G1 225.01 N 13 102804647 V301I C T missense Het probably damaging 1.000 0.142 phenotype 05/13/2019
40 543749 UTSW Mdn1 1.000 R6980 G1 225.01 N 4 32726942 G A critical splice donor site 1 bp Het probably null 05/13/2019
41 543780 UTSW Megf11 0.214 R6980 G1 225.01 N 9 64705850 E1016G A G missense Het probably damaging 1.000 phenotype 05/13/2019
42 543731 UTSW Mixl1 1.000 R6980 G1 225.01 N 1 180696888 A42V G A missense Het possibly damaging 0.507 phenotype 05/13/2019
43 543785 UTSW Mpp2 0.000 R6980 G1 225.01 N 11 102059328 W567R A G missense Het probably damaging 1.000 phenotype 05/13/2019
44 543772 UTSW Mrgpra6 0.051 R6980 G1 225.01 N 7 47188949 L136P A G missense Het probably damaging 0.968 05/13/2019
45 543752 UTSW Mroh7 0.000 R6980 G1 225.01 N 4 106700237 I759L T A missense Het probably benign 0.047 05/13/2019
46 543811 UTSW Nrxn2 0.000 R6980 G1 225.01 N 19 6450579 D277G A G missense Het probably benign 0.043 phenotype 05/13/2019
47 543744 UTSW Nup210l 0.484 R6980 G1 225.01 N 3 90119927 K205N A T missense Het probably benign 0.039 phenotype 05/13/2019
48 543735 UTSW Olfr1040 0.124 R6980 G1 225.01 N 2 86146337 Y132* A T nonsense Het probably null phenotype 05/13/2019
49 543738 UTSW Olfr1284 0.132 R6980 G1 225.01 N 2 111379275 I92V A G missense Het possibly damaging 0.775 phenotype 05/13/2019
50 543736 UTSW Olfr475-ps1 R6980 G1 225.01 N 2 88623595 *97W A G makesense Het probably null 05/13/2019
51 543774 UTSW Olfr603 0.055 R6980 G1 225.01 N 7 103383096 E302G T C missense Het probably benign 0.007 phenotype 05/13/2019
52 543796 UTSW Oxnad1 0.106 R6980 G1 225.01 N 14 32085619 C T unclassified Het probably benign 05/13/2019
53 543737 UTSW Pamr1 0.114 R6980 G1 225.01 N 2 102642204 T616I C T missense Het probably benign 0.213 0.068 05/13/2019
54 543808 UTSW Pcdhgb5 0.188 R6980 G1 225.01 N 18 37733539 H796Y C T missense Het possibly damaging 0.473 phenotype 05/13/2019
55 543791 UTSW Pdlim7 0.795 R6980 G1 225.01 N 13 55508228 D126E G T missense Het probably benign 0.348 phenotype 05/13/2019
56 543730 UTSW Pfdn2 1.000 R6980 G1 225.01 N 1 171357897 C T unclassified Het probably benign phenotype 05/13/2019
57 543810 UTSW Piezo2 1.000 R6980 G1 225.01 N 18 63082961 T A critical splice acceptor site Het probably null phenotype 05/13/2019
58 543766 UTSW Pms2 0.375 R6980 G1 225.01 N 5 143912024 I43L A T missense Het probably benign 0.214 phenotype 05/13/2019
59 543727 UTSW Prex2 0.337 R6980 G1 225.01 N 1 11162263 S851R T A missense Het probably benign 0.053 0.042 phenotype 05/13/2019
60 543729 UTSW Ptpn4 0.458 R6980 G1 225.01 N 1 119743421 E202D T A missense Het possibly damaging 0.857 phenotype 05/13/2019
61 543775 UTSW Rnf40 0.964 R6980 G1 225.01 N 7 127594677 V455E T A missense Het probably damaging 1.000 phenotype 05/13/2019
62 543798 UTSW Rp1l1 0.088 R6980 G1 225.01 N 14 64028720 N585S A G missense Het probably benign 0.020 phenotype 05/13/2019
63 543814 UTSW Rrp12 0.939 R6980 G1 225.01 N 19 41890143 S188P A G missense Het probably damaging 0.981 05/13/2019
64 543758 UTSW Rsbn1l 0.158 R6980 G1 225.01 N 5 20896484 H686L T A missense Het probably benign 0.000 05/13/2019
65 543804 UTSW Runx2 1.000 R6980 G1 225.01 N 17 44735316 V107I C T missense Het possibly damaging 0.653 phenotype 05/13/2019
66 543750 UTSW Rusc2 0.203 R6980 G1 225.01 N 4 43422846 I994M A G missense Het probably benign 0.351 phenotype 05/13/2019
67 543769 UTSW Ryr1 1.000 R6980 G1 225.01 N 7 29109387 D420V T A missense Het probably benign 0.032 phenotype 05/13/2019
68 543781 UTSW Sash1 1.000 R6980 G1 225.01 N 10 8729848 Q926R T C missense Het probably benign 0.001 phenotype 05/13/2019
69 543809 UTSW Scgb3a2 0.063 R6980 G1 225.01 N 18 43764434 I6N T A missense Het probably damaging 0.996 phenotype 05/13/2019
70 543754 UTSW Sdc3 0.153 R6980 G1 225.01 N 4 130816922 T A utr 5 prime Het probably benign phenotype 05/13/2019
71 543778 UTSW Sik2 0.828 R6980 G1 225.01 N 9 50897455 V658A A G missense Het probably benign 0.001 phenotype 05/13/2019
72 543786 UTSW Slc25a39 0.846 R6980 G1 225.01 N 11 102405775 V81A A G missense Het probably damaging 0.993 phenotype 05/13/2019
73 543800 UTSW Snai2 0.870 R6980 G1 225.01 N 16 14708249 S255T T A missense Het possibly damaging 0.922 phenotype 05/13/2019
74 543813 UTSW Sorbs1 0.779 R6980 G1 225.01 N 19 40327616 Y371* A T nonsense Het probably null phenotype 05/13/2019
75 543792 UTSW Spata31d1b 0.079 R6980 G1 225.01 N 13 59715422 H128L A T missense Het probably benign 0.258 05/13/2019
76 543782 UTSW Spdl1 0.881 R6980 G1 225.01 N 11 34830879 M1K A T start codon destroyed Het probably null 0.041 phenotype 05/13/2019
77 543740 UTSW Tgm3 0.000 R6980 G1 225.01 N 2 130026777 N211K T A missense Het probably benign 0.169 phenotype 05/13/2019
78 543765 UTSW Tmem116 0.000 R6980 G1 225.01 N 5 121467987 T C critical splice donor site 2 bp Het probably null 05/13/2019
79 543783 UTSW Tmem132e 0.360 R6980 G1 225.01 N 11 82438386 T A critical splice donor site 2 bp Het probably null 05/13/2019
80 543753 UTSW Tmem53 0.114 R6980 G1 225.01 N 4 117268508 C251R T C missense Het probably damaging 1.000 05/13/2019
81 543779 UTSW Trcg1 0.061 R6980 G1 225.01 N 9 57245573 D551A A C missense Het probably damaging 0.991 05/13/2019
82 543801 UTSW Trp63 0.870 R6980 G1 225.01 N 16 25802093 F12I T A missense Het probably benign 0.000 phenotype 05/13/2019
83 543734 UTSW Ttn 1.000 R6980 G1 225.01 N 2 76879057 C T critical splice donor site 1 bp Het probably null phenotype 05/13/2019
84 543739 UTSW Tubgcp4 1.000 R6980 G1 225.01 N 2 121195465 V596A T C missense Het probably benign 0.284 phenotype 05/13/2019
85 543762 UTSW Ugt2a3 0.096 R6980 G1 225.01 N 5 87325632 H475Q A C missense Het probably damaging 0.999 05/13/2019
86 543788 UTSW Unc79 1.000 R6980 G1 225.01 N 12 103059500 R382K G A missense Het probably damaging 0.996 phenotype 05/13/2019
87 543771 UTSW Vmn2r58 0.268 R6980 G1 225.01 N 7 41864238 H327R T C missense Het possibly damaging 0.639 05/13/2019
88 543743 UTSW Vmn2r7 0.099 R6980 G1 225.01 N 3 64716566 T111I G A missense Het possibly damaging 0.665 05/13/2019
89 543805 UTSW Zfp318 0.000 R6980 G1 225.01 N 17 46397212 Y399N T A missense Het probably damaging 1.000 phenotype 05/13/2019
[records 1 to 89 of 89]