Incidental Mutations

66 incidental mutations are currently displayed, and affect 65 genes.
12 are Possibly Damaging.
21 are Probably Damaging.
18 are Probably Benign.
13 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 66 of 66] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 545320 UTSW 1810043G02Rik 0.000 R7016 G1 225.01 Y 10 77982956 C154S T A missense Het probably benign 0.000 phenotype 05/13/2019
2 545297 UTSW Abcb4 0.000 R7016 G1 225.01 Y 5 8936843 V754D T A missense Het probably benign 0.349 phenotype 05/13/2019
3 545330 UTSW Actn1 0.367 R7016 G1 225.01 Y 12 80172968 M710L T A missense Het possibly damaging 0.936 phenotype 05/13/2019
4 545298 UTSW Adam1a 0.076 R7016 G1 225.01 Y 5 121521038 F64S A G missense Het probably benign 0.009 0.129 phenotype 05/13/2019
5 545345 UTSW Aip 1.000 R7016 G1 225.01 Y 19 4121402 D11E G T missense Het probably benign 0.001 phenotype 05/13/2019
6 545332 UTSW Ak7 0.000 R7016 G1 225.01 Y 12 105781679 Y714* T A nonsense Het probably null phenotype 05/13/2019
7 545341 UTSW Amhr2 0.836 R7016 G1 225.01 Y 15 102454364 E522G A G missense Het possibly damaging 0.633 phenotype 05/13/2019
8 545315 UTSW Amotl1 0.203 R7016 G1 225.01 Y 9 14593699 L108P A G missense Het probably damaging 0.994 phenotype 05/13/2019
9 545303 UTSW Arhgef17 0.000 R7016 G1 225.01 Y 7 100878977 S677P A G missense Het probably benign 0.000 0.118 05/13/2019
10 568404 UTSW Asph 0.000 R7016 G1 187.01 Y 4 9630604 T C intron 5297 bp Het probably null phenotype 07/17/2019
11 545294 UTSW Atp11b 0.296 R7016 G1 225.01 Y 3 35841036 S908P T C missense Het probably benign 0.000 phenotype 05/13/2019
12 545342 UTSW Atp13a3 0.457 R7016 G1 225.01 Y 16 30338490 V903L C A missense Het possibly damaging 0.544 phenotype 05/13/2019
13 545300 UTSW Bcam 0.000 R7016 G1 225.01 Y 7 19758443 R576* G A nonsense Het probably null phenotype 05/13/2019
14 545322 UTSW Btbd2 0.368 R7016 G1 225.01 Y 10 80648615 S141P A G missense Het probably damaging 0.997 phenotype 05/13/2019
15 545289 UTSW Cacna1b 0.000 R7016 G1 225.01 Y 2 24762848 N67S T C missense Het possibly damaging 0.767 phenotype 05/13/2019
16 545346 UTSW Cc2d2b 0.105 R7016 G1 225.01 Y 19 40795804 T872A A G missense Het possibly damaging 0.853 05/13/2019
17 545296 UTSW Ccdc24 0.000 R7016 G1 225.01 Y 4 117871116 I144F T A missense Het probably null 1.000 05/13/2019
18 545312 UTSW Cep44 0.544 R7016 G1 225.01 Y 8 56544199 F101L A T missense Het possibly damaging 0.894 05/13/2019
19 545288 UTSW Disp1 0.774 R7016 G1 225.01 Y 1 183087466 R1130L C A missense Het probably damaging 1.000 phenotype 05/13/2019
20 545339 UTSW Dnajc21 0.214 R7016 G1 225.01 Y 15 10461407 Y152* G T nonsense Het probably null phenotype 05/13/2019
21 545292 UTSW Edem2 0.875 R7016 G1 225.01 Y 2 155716072 F214L A G missense Het possibly damaging 0.766 phenotype 05/13/2019
22 545316 UTSW Fam118b 0.146 R7016 G1 225.01 Y 9 35223718 R198W G A missense Het probably damaging 0.996 05/13/2019
23 545333 UTSW Fam208b 0.106 R7016 G1 225.01 Y 13 3576857 V1031E A T missense Het possibly damaging 0.921 05/13/2019
24 545295 UTSW Fgb 0.825 R7016 G1 225.01 Y 3 83046064 V133A A G missense Het probably benign 0.014 0.142 phenotype 05/13/2019
25 545291 UTSW Fsip2 0.103 R7016 G1 225.01 Y 2 82990635 T5571A A G missense Het probably benign 0.254 phenotype 05/13/2019
26 545310 UTSW Gm40460 R7016 G1 157.53 N 7 142240817 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 05/13/2019
27 545286 UTSW Hjurp 0.909 R7016 G1 217.47 Y 1 88266277 CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C utr 3 prime Het probably benign 05/13/2019
28 545287 UTSW Hjurp 0.909 R7016 G1 217.47 Y 1 88266278 TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT utr 3 prime Het probably benign 05/13/2019
29 545293 UTSW Hnf4a 1.000 R7016 G1 225.01 Y 2 163564273 Y277N T A missense Het probably damaging 0.999 phenotype 05/13/2019
30 545301 UTSW Htatip2 0.646 R7016 G1 225.01 Y 7 49770835 D143G A G missense Het possibly damaging 0.644 phenotype 05/13/2019
31 545326 UTSW Itgae 0.000 R7016 G1 225.01 Y 11 73119516 N611D A G missense Het probably damaging 0.993 phenotype 05/13/2019
32 545328 UTSW Ksr1 0.152 R7016 G1 225.01 Y 11 79027536 N515K A T missense Het probably damaging 1.000 phenotype 05/13/2019
33 545323 UTSW Lrp1 1.000 R7016 G1 225.01 Y 10 127559967 C A critical splice donor site 1 bp Het probably null phenotype 05/13/2019
34 545290 UTSW Map3k20 0.000 R7016 G1 225.01 Y 2 72378635 V195D T A missense Het probably damaging 1.000 phenotype 05/13/2019
35 545329 UTSW Meox2 0.840 R7016 G1 225.01 Y 12 37109224 S132G A G missense Het probably benign 0.068 phenotype 05/13/2019
36 545314 UTSW Mmp1a 0.103 R7016 G1 214.46 N 9 7465083 TG TGG makesense Het probably null phenotype 05/13/2019
37 545340 UTSW Nell2 0.000 R7016 G1 225.01 Y 15 95229151 N781I T A missense Het possibly damaging 0.867 phenotype 05/13/2019
38 545321 UTSW Odf3l2 0.000 R7016 G1 225.01 Y 10 79639956 Y258C T C missense Het probably damaging 0.997 05/13/2019
39 545343 UTSW Olfr106-ps 0.258 R7016 G1 169.01 Y 17 37395203 G221D G A missense Het possibly damaging 0.776 05/13/2019
40 545306 UTSW Olfr513 0.102 R7016 G1 225.01 Y 7 108755711 N285S A G missense Het probably damaging 0.999 phenotype 05/13/2019
41 545308 UTSW Olfr535 0.091 R7016 G1 225.01 Y 7 140493240 T201A A G missense Het probably benign 0.007 phenotype 05/13/2019
42 545304 UTSW Olfr631 0.111 R7016 G1 225.01 Y 7 103929530 I236V A G missense Het probably benign 0.008 phenotype 05/13/2019
43 545307 UTSW Otoa 0.000 R7016 G1 212.01 Y 7 121147766 Q918L A T missense Het probably damaging 0.988 phenotype 05/13/2019
44 545313 UTSW Palld 1.000 R7016 G1 225.01 Y 8 61515998 K1022T T G missense Het probably damaging 1.000 phenotype 05/13/2019
45 545335 UTSW Parp8 0.000 R7016 G1 225.01 Y 13 116895091 S362T A T missense Het probably damaging 0.996 05/13/2019
46 545309 UTSW Phrf1 0.000 R7016 G1 225.01 Y 7 141237563 E95G A G missense Het probably damaging 0.978 05/13/2019
47 545317 UTSW Pls1 0.132 R7016 G1 225.01 Y 9 95786941 F76I A T missense Het probably damaging 0.999 phenotype 05/13/2019
48 568407 UTSW Pnp 0.130 R7016 G1 225.01 N 14 50950249 T A splice site Het probably null phenotype 07/17/2019
49 545334 UTSW Ptdss1 0.000 R7016 G1 225.01 Y 13 66972621 M294L A C missense Het probably benign 0.002 phenotype 05/13/2019
50 545338 UTSW Rictor 1.000 R7016 G1 225.01 Y 15 6774880 T A critical splice donor site 2 bp Het probably null phenotype 05/13/2019
51 545327 UTSW Rilp 0.000 R7016 G1 225.01 Y 11 75510919 E175G A G missense Het probably damaging 0.992 phenotype 05/13/2019
52 545331 UTSW Serpina16 0.059 R7016 G1 225.01 Y 12 103675371 T32S T A missense Het probably benign 0.002 05/13/2019
53 545319 UTSW Sim1 1.000 R7016 G1 225.01 Y 10 50984250 S736L C T missense Het probably benign 0.026 phenotype 05/13/2019
54 568406 UTSW Smarcc2 0.900 R7016 G1 93.01 Y 10 128485329 T G intron Het probably null phenotype 07/17/2019
55 545324 UTSW Smtn 0.588 R7016 G1 225.01 Y 11 3530368 A G critical splice donor site 2 bp Het probably null phenotype 05/13/2019
56 545299 UTSW Sspo 0.000 R7016 G1 225.01 Y 6 48449164 W98R T A missense Het probably damaging 0.999 05/13/2019
57 545344 UTSW St8sia3 0.402 R7016 G1 225.01 Y 18 64269583 I98F A T missense Het probably benign 0.006 phenotype 05/13/2019
58 568405 UTSW Taf10 1.000 R7016 G1 225.01 Y 7 105743998 A T splice site Het probably null phenotype 07/17/2019
59 545337 UTSW Tbc1d4 0.000 R7016 G1 225.01 Y 14 101487441 N580I T A missense Het probably damaging 1.000 0.276 phenotype 05/13/2019
60 545305 UTSW Trim12c 0.083 R7016 G1 225.01 Y 7 104348206 C48S A T missense Het 05/13/2019
61 545336 UTSW Tsc22d1 0.303 R7016 G1 225.01 Y 14 76417542 T405K C A missense Het probably damaging 1.000 0.260 phenotype 05/13/2019
62 545302 UTSW Tubgcp5 0.963 R7016 G1 225.01 Y 7 55794229 D2G A G missense Het possibly damaging 0.758 05/13/2019
63 545311 UTSW Wwc2 0.096 R7016 G1 225.01 Y 8 47847548 E960G T C missense Het unknown phenotype 05/13/2019
64 568403 UTSW Yme1l1 0.964 R7016 G1 225.01 Y 2 23186355 T A intron 25 bp Het probably null phenotype 07/17/2019
65 545318 UTSW Zbtb2 0.899 R7016 G1 225.01 Y 10 4368646 P460R G C missense Het probably damaging 1.000 05/13/2019
66 545325 UTSW Zfp62 0.147 R7016 G1 225.01 Y 11 49215937 I285S T G missense Het probably damaging 0.975 05/13/2019
[records 1 to 66 of 66]