Incidental Mutations

103 incidental mutations are currently displayed, and affect 103 genes.
20 are Possibly Damaging.
41 are Probably Damaging.
31 are Probably Benign.
9 are Probably Null.
3 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 103] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 546902 UTSW 1700017D01Rik 0.061 R7038 G1 225.01 Y 19 11110311 F85L A T missense Het probably benign 0.000 05/13/2019
2 546884 UTSW 2010111I01Rik 0.188 R7038 G1 225.01 Y 13 63190525 V571F G T missense Het possibly damaging 0.541 phenotype 05/13/2019
3 546816 UTSW Abl2 0.463 R7038 G1 200.01 N 1 156641409 S748P T C missense Het possibly damaging 0.946 phenotype 05/13/2019
4 546811 UTSW Alppl2 0.147 R7038 G1 225.01 Y 1 87089111 D104G T C missense Het probably damaging 1.000 phenotype 05/13/2019
5 546808 UTSW Als2 0.866 R7038 G1 225.01 Y 1 59167514 W1590L C A missense Het possibly damaging 0.944 phenotype 05/13/2019
6 546851 UTSW Aplf 0.169 R7038 G1 225.01 Y 6 87653823 W210* C T nonsense Het probably null phenotype 05/13/2019
7 546829 UTSW Ash1l 0.408 R7038 G1 225.01 Y 3 88982671 H619L A T missense Het probably benign 0.001 phenotype 05/13/2019
8 546896 UTSW Baiap3 0.000 R7038 G1 225.01 Y 17 25243840 R1075C G A missense Het probably benign 0.000 phenotype 05/13/2019
9 546823 UTSW Bpifb1 0.048 R7038 G1 225.01 Y 2 154202669 V19F G T missense Het probably damaging 0.985 phenotype 05/13/2019
10 546901 UTSW Capn1 0.000 R7038 G1 225.01 Y 19 6014319 L50Q A T missense Het probably benign 0.227 phenotype 05/13/2019
11 546880 UTSW Carmil1 0.215 R7038 G1 225.01 Y 13 24139335 S245P A G missense Het probably damaging 0.999 phenotype 05/13/2019
12 546838 UTSW Cavin4 0.000 R7038 G1 225.01 Y 4 48672479 H308R A G missense Het probably benign 0.250 phenotype 05/13/2019
13 546852 UTSW Cd4 0.000 R7038 G1 225.01 Y 6 124870254 V316M C T missense Het probably damaging 0.979 phenotype 05/13/2019
14 546866 UTSW Cdcp1 0.000 R7038 G1 225.01 Y 9 123173597 Y803C T C missense Het probably damaging 1.000 phenotype 05/13/2019
15 546878 UTSW Cep295nl 0.000 R7038 G1 225.01 Y 11 118332989 I343T A G missense Het probably benign 0.266 phenotype 05/13/2019
16 546832 UTSW Cgn 0.159 R7038 G1 225.01 Y 3 94763085 T1021P T G missense Het possibly damaging 0.802 phenotype 05/13/2019
17 546864 UTSW Col6a5 0.899 R7038 G1 225.01 Y 9 105945738 V140A A G missense Het unknown phenotype 05/13/2019
18 546812 UTSW Cops8 1.000 R7038 G1 225.01 Y 1 90603598 T C start gained Het probably benign phenotype 05/13/2019
19 546887 UTSW Crhbp 0.131 R7038 G1 225.01 Y 13 95444191 Y54H A G missense Het probably damaging 0.999 phenotype 05/13/2019
20 546904 UTSW Cyp2c29 0.085 R7038 G1 225.01 Y 19 39287127 V4I G A missense Het probably benign 0.014 05/13/2019
21 546839 UTSW Cyp2j6 0.133 R7038 G1 225.01 Y 4 96535471 Y220F T A missense Het probably benign 0.000 phenotype 05/13/2019
22 546881 UTSW D130043K22Rik 0.471 R7038 G1 225.01 Y 13 24893408 D1008G A G missense Het probably damaging 1.000 phenotype 05/13/2019
23 546853 UTSW Ddx47 0.971 R7038 G1 225.01 Y 6 135023373 V444E T A missense Het possibly damaging 0.841 phenotype 05/13/2019
24 546834 UTSW Dnttip2 0.903 R7038 G1 225.01 Y 3 122276532 C465* T A nonsense Het probably null phenotype 05/13/2019
25 546806 UTSW Dst 0.364 R7038 G1 225.01 Y 1 34182798 S2561* C A nonsense Het probably null phenotype 05/13/2019
26 546815 UTSW Dstyk 0.246 R7038 G1 225.01 Y 1 132454109 S534P T C missense Het probably benign 0.318 phenotype 05/13/2019
27 546835 UTSW Eif4e 0.858 R7038 G1 225.01 Y 3 138527182 A G unclassified Het probably benign phenotype 05/13/2019
28 546879 UTSW Eipr1 0.454 R7038 G1 142.01 Y 12 28751818 C T unclassified Het probably benign phenotype 05/13/2019
29 546809 UTSW Fastkd2 0.438 R7038 G1 225.01 Y 1 63731873 D129E T A missense Het possibly damaging 0.791 phenotype 05/13/2019
30 546828 UTSW Fndc3b 1.000 R7038 G1 225.01 Y 3 27501469 G312D C T missense Het probably benign 0.235 phenotype 05/13/2019
31 546855 UTSW Gab2 0.353 R7038 G1 225.01 Y 7 97303083 I562N T A missense Het probably damaging 0.999 phenotype 05/13/2019
32 546827 UTSW Gata5 0.000 R7038 G1 225.01 Y 2 180333892 D160Y C A missense Het possibly damaging 0.924 phenotype 05/13/2019
33 546845 UTSW Gcn1l1 0.938 R7038 G1 225.01 Y 5 115611144 V1912I G A missense Het probably damaging 0.998 05/13/2019
34 546824 UTSW Gdf5 0.489 R7038 G1 225.01 Y 2 155944735 Q107H C A missense Het probably damaging 0.993 phenotype 05/13/2019
35 546874 UTSW Gdpd1 0.220 R7038 G1 225.01 Y 11 87035292 Y276H A G missense Het probably damaging 0.999 phenotype 05/13/2019
36 546822 UTSW Gins1 1.000 R7038 G1 225.01 Y 2 150917871 Y81C A G missense Het probably damaging 1.000 phenotype 05/13/2019
37 546813 UTSW Gm28360 R7038 G1 225.01 Y 1 117853599 C107R T C missense Het probably damaging 1.000 05/13/2019
38 568380 UTSW Hadha 1.000 R7038 G1 225.01 Y 5 30120000 T C intron Het probably null phenotype 07/11/2019
39 546862 UTSW Hcn4 1.000 R7038 G1 125.01 N 9 58823584 I25F A T missense Het unknown phenotype 05/13/2019
40 546847 UTSW Hectd4 0.424 R7038 G1 225.01 Y 5 121299597 Y1095C A G missense Het possibly damaging 0.900 05/13/2019
41 546869 UTSW Hsp90b1 1.000 R7038 G1 225.01 Y 10 86695866 L73Q A T missense Het probably damaging 0.990 phenotype 05/13/2019
42 546905 UTSW Hspa12a 0.223 R7038 G1 225.01 Y 19 58804700 V351A A G missense Het probably damaging 0.999 05/13/2019
43 546863 UTSW Htr1b 0.221 R7038 G1 225.01 Y 9 81632243 M104L T A missense Het probably benign 0.000 phenotype 05/13/2019
44 568383 UTSW Ick 0.800 R7038 G1 57.01 Y 9 78109202 C T unclassified Het probably benign phenotype 07/11/2019
45 546894 UTSW Igf2r 0.687 R7038 G1 225.01 Y 17 12698325 T1563A T C missense Het probably benign 0.233 phenotype 05/13/2019
46 546882 UTSW Kif13a 0.402 R7038 G1 225.01 Y 13 46752455 V671M C T missense Het possibly damaging 0.949 phenotype 05/13/2019
47 546892 UTSW Liph 0.000 R7038 G1 225.01 Y 16 21976259 V201E A T missense Het probably damaging 1.000 phenotype 05/13/2019
48 546893 UTSW Ltn1 1.000 R7038 G1 225.01 Y 16 87424871 D196G T C missense Het probably damaging 1.000 phenotype 05/13/2019
49 546891 UTSW Med15 0.943 R7038 G1 225.01 Y 16 17652727 D589N C T missense Het possibly damaging 0.904 05/13/2019
50 546840 UTSW Mknk1 0.000 R7038 G1 225.01 Y 4 115857110 D26G A G missense Het probably damaging 0.993 phenotype 05/13/2019
51 546861 UTSW Mpi 1.000 R7038 G1 225.01 Y 9 57545217 D344G T C missense Het probably damaging 1.000 0.476 phenotype 05/13/2019
52 546876 UTSW Mrc2 0.000 R7038 G1 225.01 Y 11 105332236 E435G A G missense Het possibly damaging 0.456 phenotype 05/13/2019
53 546821 UTSW Mrps5 0.971 R7038 G1 225.01 Y 2 127600866 E285G A G missense Het probably damaging 1.000 phenotype 05/13/2019
54 546859 UTSW Muc16 0.214 R7038 G1 225.01 Y 9 18620468 M6197L T A missense Het probably damaging 0.991 phenotype 05/13/2019
55 546818 UTSW Myo3b 0.739 R7038 G1 225.01 N 2 70095208 E34D A T missense Het probably benign 0.001 phenotype 05/13/2019
56 546856 UTSW Nsd3 0.340 R7038 G1 225.01 Y 8 25641263 S215P T C missense Het probably damaging 0.996 phenotype 05/13/2019
57 546888 UTSW Nsmce2 0.719 R7038 G1 225.01 Y 15 59496830 T A intron Het probably benign phenotype 05/13/2019
58 546890 UTSW Ntan1 R7038 G1 225.01 Y 16 13826910 S37P T C missense Het probably benign 0.000 phenotype 05/13/2019
59 546830 UTSW Nup210l 0.277 R7038 G1 225.01 Y 3 90159947 Y765N T A missense Het probably damaging 1.000 phenotype 05/13/2019
60 546819 UTSW Olfr1193 0.089 R7038 G1 225.01 Y 2 88678741 R288S A T missense Het probably damaging 1.000 phenotype 05/13/2019
61 546903 UTSW Olfr1495 0.090 R7038 G1 225.01 Y 19 13768351 D3V A T missense Het probably benign 0.000 phenotype 05/13/2019
62 546871 UTSW Olfr223 0.072 R7038 G1 225.01 Y 11 59589582 Y169C T C missense Het possibly damaging 0.901 phenotype 05/13/2019
63 546860 UTSW Olfr849 0.124 R7038 G1 225.01 Y 9 19441592 L226F A C missense Het possibly damaging 0.879 phenotype 05/13/2019
64 546868 UTSW Pald1 0.387 R7038 G1 225.01 Y 10 61339299 H724R T C missense Het probably benign 0.000 05/13/2019
65 546898 UTSW Pcdhb7 0.044 R7038 G1 225.01 Y 18 37342204 D131V A T missense Het possibly damaging 0.899 05/13/2019
66 546848 UTSW Pds5b 1.000 R7038 G1 225.01 Y 5 150800760 R1269S G T missense Het probably benign 0.024 phenotype 05/13/2019
67 546810 UTSW Pikfyve 1.000 R7038 G1 225.01 Y 1 65234361 V645A T C missense Het probably damaging 0.999 phenotype 05/13/2019
68 546836 UTSW Plag1 0.531 R7038 G1 225.01 Y 4 3904676 H172N G T missense Het probably damaging 0.999 phenotype 05/13/2019
69 568379 UTSW Plch2 0.000 R7038 G1 210.01 Y 4 154990032 G C intron Het probably null phenotype 07/11/2019
70 546865 UTSW Plxnb1 0.000 R7038 G1 225.01 Y 9 109100385 V103E T A missense Het probably damaging 0.999 phenotype 05/13/2019
71 546873 UTSW Prpf8 0.983 R7038 G1 225.01 Y 11 75496158 M1143K T A missense Het probably benign 0.024 phenotype 05/13/2019
72 546807 UTSW Ptpn18 0.217 R7038 G1 218.01 Y 1 34459825 M1K T A start codon destroyed Het probably null 0.998 phenotype 05/13/2019
73 546886 UTSW Rasgrf2 0.424 R7038 G1 225.01 Y 13 91982833 T703I G A missense Het possibly damaging 0.950 phenotype 05/13/2019
74 546842 UTSW Rassf6 0.065 R7038 G1 225.01 Y 5 90609725 H125Q A T missense Het probably benign 0.128 phenotype 05/13/2019
75 546843 UTSW Sdad1 0.966 R7038 G1 225.01 Y 5 92298190 A G critical splice donor site 2 bp Het probably null 05/13/2019
76 546841 UTSW Sf3a3 0.973 R7038 G1 225.01 Y 4 124728426 F426L T A missense Het probably benign 0.158 phenotype 05/13/2019
77 546889 UTSW Sgsm3 0.469 R7038 G1 225.01 Y 15 81008375 F6L T C missense Het possibly damaging 0.861 05/13/2019
78 546899 UTSW Slc14a2 0.000 R7038 G1 225.01 Y 18 78159037 I626N A T missense Het probably damaging 0.982 phenotype 05/13/2019
79 546870 UTSW Slc17a8 0.172 R7038 G1 225.01 Y 10 89600221 N165S T C missense Het probably benign 0.003 phenotype 05/13/2019
80 546814 UTSW Slc41a1 0.340 R7038 G1 225.01 Y 1 131842057 A305D C A missense Het possibly damaging 0.604 05/13/2019
81 546872 UTSW Smyd4 0.446 R7038 G1 225.01 Y 11 75390514 P271Q C A missense Het probably damaging 1.000 phenotype 05/13/2019
82 546833 UTSW Spag17 0.490 R7038 G1 225.01 Y 3 99984609 H260N C A missense Het probably benign 0.001 phenotype 05/13/2019
83 546826 UTSW Spata2 0.245 R7038 G1 225.01 Y 2 167485363 V38E A T missense Het possibly damaging 0.563 phenotype 05/13/2019
84 546831 UTSW Sprr2b 0.166 R7038 G1 214.46 Y 3 92317519 CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC small deletion Het probably benign 05/13/2019
85 546817 UTSW Syt14 0.000 R7038 G1 225.01 Y 1 192983658 T A intron Het probably benign phenotype 05/13/2019
86 546875 UTSW Tbx21 0.156 R7038 G1 225.01 Y 11 97099771 S329P A G missense Het probably damaging 0.995 phenotype 05/13/2019
87 546877 UTSW Tex2 0.212 R7038 G1 225.01 Y 11 106511900 A T critical splice donor site 2 bp Het probably null 05/13/2019
88 546820 UTSW Tmem62 0.558 R7038 G1 225.01 Y 2 120993577 I244M A G missense Het possibly damaging 0.868 05/13/2019
89 546858 UTSW Tnks 0.000 R7038 G1 225.01 Y 8 34851636 N830K A T missense Het probably damaging 0.991 phenotype 05/13/2019
90 546825 UTSW Tox2 0.320 R7038 G1 225.01 Y 2 163314344 E145G A G missense Het probably damaging 0.990 05/13/2019
91 546846 UTSW Tpcn1 0.000 R7038 G1 225.01 Y 5 120585277 D7G T C missense Het probably damaging 0.994 phenotype 05/13/2019
92 546844 UTSW Ttc28 0.624 R7038 G1 225.01 Y 5 111266579 M1320K T A missense Het probably benign 0.086 05/13/2019
93 546854 UTSW Tubgcp5 0.973 R7038 G1 225.01 Y 7 55805366 V270G T G missense Het probably damaging 0.994 05/13/2019
94 546883 UTSW Unc5a 0.000 R7038 G1 225.01 Y 13 55004484 R62G A G missense Het probably damaging 0.998 phenotype 05/13/2019
95 546857 UTSW Unc5d 0.309 R7038 G1 225.01 Y 8 28715721 A G critical splice donor site 2 bp Het probably null phenotype 05/13/2019
96 546867 UTSW Utrn 0.000 R7038 G1 225.01 Y 10 12682338 H1459R T C missense Het probably damaging 0.998 phenotype 05/13/2019
97 546895 UTSW Vmn2r100 0.068 R7038 G1 225.01 Y 17 19505001 L64Q T A missense Het possibly damaging 0.764 05/13/2019
98 546897 UTSW Wdr55 1.000 R7038 G1 225.01 Y 18 36760420 L45R T G missense Het probably damaging 0.998 phenotype 05/13/2019
99 546837 UTSW Zfp292 0.583 R7038 G1 225.01 Y 4 34816357 Y306H A G missense Het probably damaging 0.999 05/13/2019
100 546849 UTSW Zfp398 0.209 R7038 G1 225.01 Y 6 47866309 D300Y G T missense Het probably damaging 1.000 phenotype 05/13/2019
[records 1 to 100 of 103] next >> last >|