Incidental Mutations

76 incidental mutations are currently displayed, and affect 75 genes.
8 are Possibly Damaging.
25 are Probably Damaging.
31 are Probably Benign.
9 are Probably Null.
4 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 554253 UTSW Ano2 0.091 R7153 G1 225.01 Y 6 125992943 T741A A G missense Het possibly damaging 0.729 phenotype 05/15/2019
2 554226 UTSW Aox4 0.000 R7153 G1 225.01 Y 1 58250219 M767T T C missense Het probably damaging 0.988 phenotype 05/15/2019
3 554279 UTSW Arhgap39 0.243 R7153 G1 225.01 Y 15 76765491 S27I C A missense Het probably benign 0.093 05/15/2019
4 554255 UTSW AU018091 0.189 R7153 G1 225.01 Y 7 3159513 M296L T A missense Het probably benign 0.014 05/15/2019
5 554286 UTSW Axin1 1.000 R7153 G1 225.01 Y 17 26187968 T512A A G missense Het probably benign 0.000 phenotype 05/15/2019
6 554252 UTSW B4galnt3 0.064 R7153 G1 225.01 Y 6 120214968 D602E A T missense Het probably benign 0.001 phenotype 05/15/2019
7 554282 UTSW Bcl6 0.951 R7153 G1 225.01 Y 16 23966226 R675* G A nonsense Het probably null 0.566 phenotype 05/15/2019
8 554246 UTSW Bsnd 0.063 R7153 G1 225.01 Y 4 106492033 D3E A T missense Het probably benign 0.094 phenotype 05/15/2019
9 554235 UTSW Btbd18 0.179 R7153 G1 225.01 Y 2 84666428 R137* C T nonsense Het probably null 0.652 phenotype 05/15/2019
10 554254 UTSW C2cd5 0.317 R7153 G1 225.01 Y 6 143019409 S871P A G missense Het probably benign 0.044 05/15/2019
11 554267 UTSW Cobl 0.000 R7153 G1 225.01 N 11 12254128 P858Q G T missense Het probably damaging 1.000 phenotype 05/15/2019
12 568689 UTSW Col6a1 0.223 R7153 G1 225.01 Y 10 76710341 C T splice site 5 bp Het probably null phenotype 09/12/2019
13 554232 UTSW Crb2 1.000 R7153 G1 225.01 Y 2 37787408 H304L A T missense Het probably benign 0.001 0.220 phenotype 05/15/2019
14 554265 UTSW Crybg1 1.000 R7153 G1 225.01 Y 10 43964666 Y1812F T A missense Het possibly damaging 0.636 05/15/2019
15 554260 UTSW Ddx60 0.141 R7153 G1 225.01 Y 8 61988108 K1070N A T missense Het possibly damaging 0.712 phenotype 05/15/2019
16 554239 UTSW Defb22 0.000 R7153 G1 225.01 Y 2 152485920 K115R T C missense Het unknown 05/15/2019
17 568690 UTSW Dhx8 0.964 R7153 G1 77.01 Y 11 101740175 C T intron 327 bp Het probably null phenotype 09/12/2019
18 568691 UTSW Dnah5 0.828 R7153 G1 225.01 Y 15 28365522 T A intron Het probably null phenotype 09/12/2019
19 554225 UTSW Dnah7b 0.166 R7153 G1 225.01 Y 1 46126804 F543Y T A missense Het probably benign 0.045 05/15/2019
20 554281 UTSW Ehhadh 0.000 R7153 G1 225.01 Y 16 21766321 F270S A G missense Het probably damaging 1.000 0.478 phenotype 05/15/2019
21 554273 UTSW Esyt2 0.000 R7153 G1 225.01 Y 12 116346508 M397V A G missense Het probably benign 0.001 phenotype 05/15/2019
22 554262 UTSW Fanca 0.752 R7153 G1 225.01 Y 8 123316425 L74H A T missense Het probably damaging 0.999 phenotype 05/15/2019
23 554290 UTSW Fbxl17 0.374 R7153 G1 225.01 Y 17 63060351 V676F C A missense Het probably benign 0.088 phenotype 05/15/2019
24 554285 UTSW Fndc1 0.073 R7153 G1 225.01 Y 17 7801645 V102A A G missense Het probably damaging 0.998 05/15/2019
25 554278 UTSW Gpalpp1 R7153 G1 218.01 Y 14 76095011 Y273C T C missense Het probably damaging 1.000 05/15/2019
26 554270 UTSW Gpatch8 0.371 R7153 G1 217.47 Y 11 102480188 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC small insertion Het probably benign phenotype 05/15/2019
27 554266 UTSW Grik2 0.000 R7153 G1 225.01 Y 10 49535367 H225R T C missense Het probably benign 0.003 phenotype 05/15/2019
28 554241 UTSW Helz2 0.000 R7153 G1 225.01 Y 2 181231285 S2411T A T missense Het probably benign 0.003 phenotype 05/15/2019
29 554231 UTSW Hnmt 0.122 R7153 G1 225.01 Y 2 24014341 A103T C T missense Het probably damaging 0.978 phenotype 05/15/2019
30 554272 UTSW Ighv15-2 0.284 R7153 G1 225.01 Y 12 114564590 Y114* G T nonsense Het probably null 05/15/2019
31 554251 UTSW Irak2 0.000 R7153 G1 225.01 Y 6 113678709 H357R A G missense Het probably benign 0.344 phenotype 05/15/2019
32 554249 UTSW Kcp 0.272 R7153 G1 225.01 Y 6 29499015 E320G T C missense Het probably damaging 0.997 phenotype 05/15/2019
33 554242 UTSW Kpna4 0.000 R7153 G1 225.01 Y 3 69089798 L352S A G missense Het probably damaging 1.000 phenotype 05/15/2019
34 554269 UTSW Krt36 0.051 R7153 G1 225.01 Y 11 100105146 Q151* G A nonsense Het probably null phenotype 05/15/2019
35 554280 UTSW Krt77 0.000 R7153 G1 225.01 Y 15 101865496 T241M G A missense Het probably benign 0.176 phenotype 05/15/2019
36 554284 UTSW Lca5l 0.065 R7153 G1 225.01 Y 16 96173809 N305I T A missense Het probably damaging 0.984 05/15/2019
37 554228 UTSW Lefty1 1.000 R7153 G1 225.01 Y 1 180937767 L300Q T A missense Het probably benign 0.007 phenotype 05/15/2019
38 554238 UTSW Mertk 0.147 R7153 G1 225.01 Y 2 128736649 Y185C A G missense Het probably damaging 0.993 phenotype 05/15/2019
39 554276 UTSW Mmp14 0.931 R7153 G1 225.01 Y 14 54436251 I124T T C missense Het possibly damaging 0.926 phenotype 05/15/2019
40 554291 UTSW Nlrc4 0.143 R7153 G1 225.01 Y 17 74447103 E95G T C missense Het possibly damaging 0.841 phenotype 05/15/2019
41 554293 UTSW Npc1 0.462 R7153 G1 225.01 Y 18 12213291 F283L A G missense Het possibly damaging 0.776 phenotype 05/15/2019
42 554236 UTSW Olfr1180 0.097 R7153 G1 225.01 Y 2 88412118 L180W A C missense Het probably damaging 1.000 0.021 phenotype 05/15/2019
43 554237 UTSW Olfr1282 0.120 R7153 G1 225.01 Y 2 111335901 M59K A T missense Het probably damaging 0.998 phenotype 05/15/2019
44 554294 UTSW Pcdha11 0.237 R7153 G1 225.01 Y 18 37011225 V123A T C missense Het probably damaging 1.000 phenotype 05/15/2019
45 554295 UTSW Pcdhga2 0.100 R7153 G1 225.01 Y 18 37669208 V35A T C missense Het probably damaging 0.996 phenotype 05/15/2019
46 554248 UTSW Pgd 0.957 R7153 G1 225.01 Y 4 149161678 T94K G T missense Het probably benign 0.000 phenotype 05/15/2019
47 554258 UTSW Pik3c2a 1.000 R7153 G1 225.01 Y 7 116342252 N1593S T C missense Het probably damaging 1.000 phenotype 05/15/2019
48 554261 UTSW Pkd1l3 0.000 R7153 G1 214.46 Y 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign phenotype 05/15/2019
49 554296 UTSW Plcb3 0.567 R7153 G1 225.01 Y 19 6958084 A G critical splice donor site 2 bp Het probably null phenotype 05/15/2019
50 554292 UTSW Prkd3 0.215 R7153 G1 225.01 Y 17 78966355 D491N C T missense Het probably benign 0.042 phenotype 05/15/2019
51 554247 UTSW Ptprf 0.742 R7153 G1 225.01 Y 4 118231543 T688A T C missense Het probably damaging 0.996 phenotype 05/15/2019
52 554227 UTSW Pycr2 0.000 R7153 G1 225.01 Y 1 180906682 L210M T A missense Het probably damaging 0.981 phenotype 05/15/2019
53 554289 UTSW Rpl36 0.952 R7153 G1 225.01 Y 17 56614137 I81T T C missense Het probably benign 0.074 05/15/2019
54 554245 UTSW Rraga 1.000 R7153 G1 225.01 Y 4 86576016 A33V C T missense Het probably damaging 1.000 phenotype 05/15/2019
55 554288 UTSW Slc29a1 0.000 R7153 G1 225.01 Y 17 45585762 A429V G A missense Het probably damaging 1.000 phenotype 05/15/2019
56 554274 UTSW Stab1 0.000 R7153 G1 225.01 Y 14 31160584 E432A T G missense Het probably benign 0.164 phenotype 05/15/2019
57 554283 UTSW Synj1 1.000 R7153 G1 225.01 Y 16 90948090 G1189R C T missense Het probably benign 0.040 phenotype 05/15/2019
58 554243 UTSW Synpo2 1.000 R7153 G1 225.01 Y 3 123112404 *1088Q A G makesense Het probably null 05/15/2019
59 554264 UTSW Tbc1d21 0.128 R7153 G1 225.01 Y 9 58363093 D133G T C missense Het probably damaging 1.000 05/15/2019
60 554268 UTSW Tenm2 0.561 R7153 G1 225.01 Y 11 36024182 V2176A A G missense Het probably damaging 0.976 phenotype 05/15/2019
61 554287 UTSW Tff1 0.000 R7153 G1 225.01 Y 17 31162798 I35T A G missense Het probably benign 0.001 phenotype 05/15/2019
62 554230 UTSW Thnsl1 0.110 R7153 G1 225.01 Y 2 21212953 V506A T C missense Het possibly damaging 0.636 05/15/2019
63 554257 UTSW Timm10b 0.208 R7153 G1 225.01 Y 7 105640880 Q50R A G missense Het unknown phenotype 05/15/2019
64 554297 UTSW Tjp2 1.000 R7153 G1 225.01 Y 19 24101981 N843K A T missense Het probably benign 0.401 phenotype 05/15/2019
65 554244 UTSW Tle1 0.741 R7153 G1 225.01 Y 4 72139061 F101I A T missense Het probably benign 0.026 05/15/2019
66 554263 UTSW Tmem225 0.069 R7153 G1 225.01 Y 9 40148368 F15L T C missense Het probably benign 0.010 05/15/2019
67 554275 UTSW Trav12-3 R7153 G1 225.01 Y 14 53622161 L88P T C missense Het probably benign 0.274 0.129 05/15/2019
68 554271 UTSW Ttc7b 0.488 R7153 G1 225.01 Y 12 100355034 W613R A T missense Het probably damaging 0.998 0.450 05/15/2019
69 554233 UTSW Ttn 1.000 R7153 G1 225.01 Y 2 76778504 M17723L T A missense Het probably benign 0.003 0.118 phenotype 05/15/2019
70 554234 UTSW Ttn 1.000 R7153 G1 225.01 Y 2 76945316 D1840G T C missense Het unknown 0.088 phenotype 05/15/2019
71 554259 UTSW Tubgcp2 0.950 R7153 G1 225.01 Y 7 140001036 H668R T C missense Het probably benign 0.000 05/15/2019
72 554229 UTSW Ush2a 0.615 R7153 G1 225.01 Y 1 188728484 N2647K C A missense Het possibly damaging 0.929 phenotype 05/15/2019
73 554250 UTSW Vmn1r14 0.195 R7153 G1 225.01 Y 6 57233866 S143F C T missense Het probably benign 0.101 0.155 05/15/2019
74 554256 UTSW Vmn2r70 0.089 R7153 G1 225.01 Y 7 85565054 S297P A G missense Het probably damaging 0.999 0.028 05/15/2019
75 554240 UTSW Ywhab 0.000 R7153 G1 225.01 Y 2 164014060 F119L T C missense Het probably damaging 0.989 phenotype 05/15/2019
76 554277 UTSW Zmym2 0.659 R7153 G1 225.01 Y 14 56950202 D1108E T A missense Het probably benign 0.161 phenotype 05/15/2019
[records 1 to 76 of 76]