Incidental Mutations

69 incidental mutations are currently displayed, and affect 68 genes.
16 are Possibly Damaging.
23 are Probably Damaging.
21 are Probably Benign.
8 are Probably Null.
3 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 69 of 69] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 558138 UTSW Adamts14 0.000 R7169 G1 225.01 N 10 61204928 V870A A G missense Het probably damaging 0.974 phenotype 06/26/2019
2 558135 UTSW Ahi1 0.817 R7169 G1 225.01 N 10 21055019 D919E T G missense Het probably damaging 1.000 phenotype 06/26/2019
3 558131 UTSW Angptl6 0.272 R7169 G1 225.01 N 9 20875179 R390S T A missense Het probably damaging 0.997 phenotype 06/26/2019
4 558106 UTSW Arhgef11 0.000 R7169 G1 225.01 N 3 87727448 I873V A G missense Het possibly damaging 0.788 phenotype 06/26/2019
5 558139 UTSW BC024063 0.154 R7169 G1 181.01 N 10 82110459 Y638H T C missense Het possibly damaging 0.877 06/26/2019
6 558120 UTSW Brsk1 0.000 R7169 G1 225.01 N 7 4715404 S751P T C missense Het probably benign 0.000 phenotype 06/26/2019
7 558093 UTSW Cdh20 0.220 R7169 G1 225.01 N 1 104947353 A287T G A missense Het possibly damaging 0.910 phenotype 06/26/2019
8 558097 UTSW Clic3 0.197 R7169 G1 225.01 N 2 25458719 R237H G A missense Het probably benign 0.016 phenotype 06/26/2019
9 558105 UTSW Cog6 0.000 R7169 G1 225.01 N 3 52989966 P562H G T missense Het possibly damaging 0.936 phenotype 06/26/2019
10 558128 UTSW Csnk2a2 0.751 R7169 G1 97.01 N 8 95488378 Y24H A G missense Het phenotype 06/26/2019
11 558154 UTSW Ctif 0.164 R7169 G1 225.01 N 18 75472016 D484G T C missense Het probably damaging 0.990 phenotype 06/26/2019
12 558148 UTSW Dennd6b 0.131 R7169 G1 225.01 N 15 89188852 F161I A T missense Het possibly damaging 0.795 06/26/2019
13 558096 UTSW Dnah14 0.079 R7169 G1 225.01 N 1 181702365 V2235L G T missense Het probably benign 0.001 phenotype 06/26/2019
14 558116 UTSW Dnah6 0.152 R7169 G1 225.01 N 6 73038746 V3636D A T missense Het probably damaging 1.000 phenotype 06/26/2019
15 558104 UTSW Dpm1 1.000 R7169 G1 225.01 N 2 168211423 Y207* A T nonsense Het probably null phenotype 06/26/2019
16 558156 UTSW Eml3 0.800 R7169 G1 225.01 N 19 8933464 T227A A G missense Het probably damaging 0.999 06/26/2019
17 558153 UTSW Enpp5 0.000 R7169 G1 225.01 N 17 44085264 G356S G A missense Het probably damaging 1.000 0.260 phenotype 06/26/2019
18 558147 UTSW Eppk1 0.275 R7169 G1 225.01 N 15 76105914 A2256S C A missense Het probably benign 0.050 phenotype 06/26/2019
19 558110 UTSW Etnppl 0.101 R7169 G1 225.01 N 3 130620696 N80I A T missense Het probably damaging 1.000 06/26/2019
20 558136 UTSW Eya4 1.000 R7169 G1 225.01 N 10 23155947 N236K A T missense Het probably benign 0.416 phenotype 06/26/2019
21 558137 UTSW Fam26e 0.062 R7169 G1 225.01 N 10 34092164 T298S T A missense Het probably damaging 0.995 06/26/2019
22 558141 UTSW Fam49a 0.164 R7169 G1 225.01 N 12 12359232 D71G A G missense Het possibly damaging 0.810 06/26/2019
23 558142 UTSW Fam84a 0.135 R7169 G1 225.01 N 12 14150618 F36S A G missense Het probably damaging 0.992 06/26/2019
24 558112 UTSW Gm12886 0.067 R7169 G1 225.01 N 4 121416751 Q89H T G missense Het probably damaging 0.974 06/26/2019
25 558114 UTSW Gsdme 0.000 R7169 G1 225.01 N 6 50227378 T200A T C missense Het probably benign 0.002 phenotype 06/26/2019
26 558109 UTSW Hipk1 0.000 R7169 G1 225.01 N 3 103744217 A1122T C T missense Het probably benign 0.000 phenotype 06/26/2019
27 558092 UTSW Icos 0.133 R7169 G1 225.01 N 1 60995546 D176G A G missense Het probably damaging 0.999 phenotype 06/26/2019
28 558115 UTSW Igkv5-43 R7169 G1 225.01 N 6 69823535 Y56F T A missense Het probably damaging 0.983 06/26/2019
29 558091 UTSW Il1r1 0.082 R7169 G1 225.01 N 1 40293359 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
30 558095 UTSW Ildr2 0.389 R7169 G1 225.01 N 1 166307934 G A critical splice donor site 1 bp Het probably null phenotype 06/26/2019
31 558132 UTSW Ilf3 1.000 R7169 G1 225.01 N 9 21395426 H305Q T A missense Het probably damaging 0.962 phenotype 06/26/2019
32 558107 UTSW Insrr 0.273 R7169 G1 225.01 N 3 87808594 H532R A G missense Het probably benign 0.154 phenotype 06/26/2019
33 558149 UTSW Lmbr1l 0.000 R7169 G1 217.47 N 15 98909158 CACTACATACTACATACTACATACTACATACTACATACTACATAC CACTACATACTACATACTACATACTACATACTACATACTACATACTACATAC frame shift Het probably null phenotype 06/26/2019
34 558150 UTSW Lmbr1l 0.000 R7169 G1 217.47 N 15 98909194 ACTACAT ACTACATGCTACAT critical splice donor site Het probably benign phenotype 06/26/2019
35 558127 UTSW Lrrc25 0.074 R7169 G1 225.01 N 8 70617787 S73A T G missense Het probably benign 0.271 06/26/2019
36 558117 UTSW Lrrn1 0.270 R7169 G1 225.01 N 6 107567604 L121P T C missense Het probably damaging 0.999 phenotype 06/26/2019
37 558146 UTSW Ly6c1 0.116 R7169 G1 216.01 N 15 75044646 V116L C A missense Het probably benign 0.005 06/26/2019
38 558151 UTSW Meltf 0.000 R7169 G1 225.01 N 16 31880162 D30G A G missense Het probably benign 0.408 phenotype 06/26/2019
39 558111 UTSW Mroh7 0.000 R7169 G1 225.01 N 4 106691639 D1009V T A missense Het probably damaging 0.990 06/26/2019
40 558099 UTSW Mybpc3 0.721 R7169 G1 225.01 N 2 91118179 V4A T C missense Het possibly damaging 0.845 phenotype 06/26/2019
41 558145 UTSW Mycbp2 1.000 R7169 G1 225.01 N 14 103260200 S979P A G missense Het possibly damaging 0.783 phenotype 06/26/2019
42 558121 UTSW Ntn5 0.071 R7169 G1 225.01 N 7 45686774 R210* C T nonsense Het probably null phenotype 06/26/2019
43 558140 UTSW Nuak1 1.000 R7169 G1 225.01 N 10 84374745 D493G T C missense Het probably damaging 0.998 phenotype 06/26/2019
44 558100 UTSW Olfr1281 0.102 R7169 G1 225.01 N 2 111328598 Y60N T A missense Het probably damaging 1.000 phenotype 06/26/2019
45 558101 UTSW Olfr1306 0.099 R7169 G1 225.01 N 2 111912594 M112T A G missense Het possibly damaging 0.950 phenotype 06/26/2019
46 558119 UTSW Olfr211 0.622 R7169 G1 225.01 N 6 116494064 A152S G T missense Het probably benign 0.015 phenotype 06/26/2019
47 558123 UTSW Olfr680-ps1 0.430 R7169 G1 225.01 N 7 105091190 I150V T C missense Het possibly damaging 0.711 06/26/2019
48 558090 UTSW Oprk1 0.226 R7169 G1 225.01 N 1 5589081 D11E T A missense Het probably benign 0.000 phenotype 06/26/2019
49 558130 UTSW Pkd1l2 0.000 R7169 G1 225.01 N 8 117040835 T1239S T A missense Het possibly damaging 0.821 phenotype 06/26/2019
50 558133 UTSW Pkm 1.000 R7169 G1 222.01 N 9 59671625 D296G A G missense Het possibly damaging 0.946 phenotype 06/26/2019
51 558158 UTSW Pof1b R7169 G1 222 N X 112644345 I544T A G missense Het probably benign 0.136 phenotype 06/26/2019
52 558113 UTSW Pop5 0.227 R7169 G1 225.01 N 5 115240228 V77E T A missense Het possibly damaging 0.875 06/26/2019
53 558152 UTSW Ppp1r10 1.000 R7169 G1 225.01 N 17 35929473 S552P T C missense Het probably damaging 0.997 phenotype 06/26/2019
54 558144 UTSW Rabggta 0.965 R7169 G1 200.01 N 14 55720901 R101P C G missense Het probably damaging 0.985 phenotype 06/26/2019
55 558108 UTSW Rorc 0.823 R7169 G1 225.01 N 3 94389180 E243V A T missense Het probably benign 0.002 phenotype 06/26/2019
56 558118 UTSW Setmar 0.000 R7169 G1 225.01 N 6 108065088 A3E C A missense Het possibly damaging 0.930 phenotype 06/26/2019
57 558155 UTSW Skor2 1.000 R7169 G1 225.01 N 18 76860986 V801E T A missense Het probably benign 0.043 phenotype 06/26/2019
58 558143 UTSW Slc12a7 0.000 R7169 G1 225.01 N 13 73784560 V56M G A missense Het probably benign 0.300 phenotype 06/26/2019
59 558102 UTSW Snph 0.000 R7169 G1 225.01 N 2 151594387 N207I T A missense Het probably damaging 0.999 phenotype 06/26/2019
60 558134 UTSW Snx14 1.000 R7169 G1 225.01 N 9 88398309 V531A A G missense Het probably damaging 0.976 phenotype 06/26/2019
61 558125 UTSW Thap1 0.808 R7169 G1 173.47 N 8 26160856 CAGCATCTGCTCGGAGCA CAGCA frame shift Het probably null phenotype 06/26/2019
62 558126 UTSW Tlr3 0.101 R7169 G1 225.01 N 8 45397019 M871K A T missense Het probably damaging 0.996 phenotype 06/26/2019
63 558094 UTSW Tnfrsf11a 0.150 R7169 G1 225.01 N 1 105844695 R569S A T missense Het possibly damaging 0.947 phenotype 06/26/2019
64 558124 UTSW Trim66 0.230 R7169 G1 225.01 N 7 109455121 V1294A A G missense Het probably benign 0.252 06/26/2019
65 558157 UTSW Vldlr 0.337 R7169 G1 225.01 N 19 27244328 V698I G A missense Het probably benign 0.000 phenotype 06/26/2019
66 558122 UTSW Vmn2r73 0.197 R7169 G1 225.01 N 7 85858455 Q550* G A nonsense Het probably null 06/26/2019
67 558098 UTSW Zdhhc5 0.464 R7169 G1 225.01 N 2 84702331 A T critical splice donor site 2 bp Het probably null 06/26/2019
68 558129 UTSW Zfhx3 0.937 R7169 G1 225.01 N 8 108951398 Y3027N T A missense Het possibly damaging 0.861 phenotype 06/26/2019
69 558103 UTSW Zfp663 0.069 R7169 G1 225.01 N 2 165352439 S620N C T missense Het probably benign 0.001 06/26/2019
[records 1 to 69 of 69]