Incidental Mutations

64 incidental mutations are currently displayed, and affect 64 genes.
11 are Possibly Damaging.
11 are Probably Damaging.
29 are Probably Benign.
10 are Probably Null.
3 create premature stop codons.
2 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 64 of 64] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 558483 UTSW 1700018F24Rik 0.073 R7174 G1 225.01 Y 5 145044817 A154E C A missense Het probably benign 0.272 06/26/2019
2 558517 UTSW Adamts1 0.000 R7174 G1 225.01 Y 16 85799172 A419S C A missense Het probably benign 0.001 0.196 phenotype 06/26/2019
3 558481 UTSW Arap2 0.000 R7174 G1 225.01 Y 5 62604278 V1702L C G missense Het probably benign 0.000 phenotype 06/26/2019
4 558484 UTSW Arpc1a 0.842 R7174 G1 225.01 Y 5 145097277 P152S C T missense Het probably benign 0.382 phenotype 06/26/2019
5 558502 UTSW Bbs10 1.000 R7174 G1 225.01 Y 10 111300767 C580* T A nonsense Het probably null phenotype 06/26/2019
6 558490 UTSW Bcam 0.000 R7174 G1 225.01 Y 7 19765451 Y216H A G missense Het probably damaging 1.000 phenotype 06/26/2019
7 558493 UTSW C2cd3 1.000 R7174 G1 225.01 Y 7 100432198 S1016P T C missense Het phenotype 06/26/2019
8 558511 UTSW Card6 0.000 R7174 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG small deletion Het probably benign phenotype 06/26/2019
9 558516 UTSW Cd86 0.095 R7174 G1 217.47 Y 16 36606555 CA CAA frame shift Het probably null phenotype 06/26/2019
10 558489 UTSW Ceacam5 0.067 R7174 G1 225.01 Y 7 17757914 T A critical splice donor site 2 bp Het probably null 06/26/2019
11 558477 UTSW Cfap57 0.000 R7174 G1 225.01 Y 4 118589067 V666A A G missense Het probably benign 0.353 phenotype 06/26/2019
12 558486 UTSW Cntn3 0.000 R7174 G1 225.01 Y 6 102165344 F1021L A G missense Het probably benign 0.000 06/26/2019
13 558466 UTSW Cr1l 1.000 R7174 G1 225.01 Y 1 195129189 G119D C T missense Het probably benign 0.003 0.202 phenotype 06/26/2019
14 558509 UTSW Fgf10 1.000 R7174 G1 225.01 Y 13 118715406 H8L A T missense Het probably benign 0.387 0.212 phenotype 06/26/2019
15 558482 UTSW Fras1 0.000 R7174 G1 225.01 Y 5 96755577 T A critical splice donor site 2 bp Het probably null phenotype 06/26/2019
16 558474 UTSW Frem1 0.819 R7174 G1 225.01 Y 4 82922256 T1811N G T missense Het probably benign 0.003 phenotype 06/26/2019
17 558519 UTSW Fsd1 0.415 R7174 G1 225.01 Y 17 55991356 Q227L A T missense Het probably benign 0.007 phenotype 06/26/2019
18 558469 UTSW Galk2 0.000 R7174 G1 225.01 Y 2 125896701 I138M A G missense Het probably damaging 0.999 phenotype 06/26/2019
19 558479 UTSW Gm5152 R7174 G1 225.01 Y 5 10245270 K56E T C missense Het probably damaging 0.998 06/26/2019
20 558485 UTSW Igkv8-30 R7174 G1 225.01 Y 6 70117598 V7A A G missense Het possibly damaging 0.673 06/26/2019
21 558499 UTSW Katnb1 1.000 R7174 G1 225.01 Y 8 95097441 A450T G A missense Het probably benign 0.001 phenotype 06/26/2019
22 558465 UTSW Kif14 0.919 R7174 G1 225.01 Y 1 136521257 E1465V A T missense Het possibly damaging 0.669 phenotype 06/26/2019
23 568605 UTSW Klra3 0.057 R7174 G1 132.01 Y 6 130335978 A T intron Het probably null 08/29/2019
24 558504 UTSW Krt9 0.000 R7174 G1 214.46 N 11 100189077 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC small deletion Het probably benign 0.156 phenotype 06/26/2019
25 558475 UTSW Lepr 0.000 R7174 G1 225.01 Y 4 101750338 N251S A G missense Het probably benign 0.006 phenotype 06/26/2019
26 558467 UTSW Lrp2 1.000 R7174 G1 225.01 Y 2 69433072 M4379V T C missense Het probably benign 0.112 phenotype 06/26/2019
27 558501 UTSW Lrriq1 0.080 R7174 G1 225.01 Y 10 103224965 N92S T C missense Het probably benign 0.000 06/26/2019
28 558515 UTSW Map3k13 0.000 R7174 G1 225.01 Y 16 21926256 N855S A G missense Het probably damaging 0.999 phenotype 06/26/2019
29 558514 UTSW Marf1 0.158 R7174 G1 225.01 Y 16 14136953 D900V T A missense Het probably damaging 0.997 phenotype 06/26/2019
30 558513 UTSW Nckap5l 0.220 R7174 G1 225.01 Y 15 99424003 M1087K A T missense Het probably benign 0.087 06/26/2019
31 558491 UTSW Nlrp9c 0.000 R7174 G1 225.01 Y 7 26385297 N286D T C missense Het probably benign 0.034 06/26/2019
32 558468 UTSW Olfr1009 0.076 R7174 G1 225.01 Y 2 85721953 P183S C T missense Het possibly damaging 0.812 phenotype 06/26/2019
33 558473 UTSW Olfr159 0.150 R7174 G1 225.01 N 4 43770691 A107T C T missense Het not run phenotype 06/26/2019
34 558496 UTSW Olfr497 0.108 R7174 G1 225.01 Y 7 108423160 S196R T A missense Het probably benign 0.009 phenotype 06/26/2019
35 558497 UTSW Olfr533 0.127 R7174 G1 225.01 Y 7 140467163 *321Q T C makesense Het probably null phenotype 06/26/2019
36 558495 UTSW Olfr615 0.058 R7174 G1 225.01 Y 7 103561391 R305* A T nonsense Het probably null phenotype 06/26/2019
37 558510 UTSW Olfr730 0.194 R7174 G1 225.01 Y 14 50186696 I175V T C missense Het probably benign 0.001 phenotype 06/26/2019
38 558522 UTSW Pcdhga3 0.115 R7174 G1 225.01 Y 18 37675927 T478A A G missense Het probably benign 0.024 0.146 phenotype 06/26/2019
39 558523 UTSW Pdgfrb 1.000 R7174 G1 225.01 Y 18 61066515 I385T T C missense Het probably benign 0.000 0.193 phenotype 06/26/2019
40 558498 UTSW Poteg 0.086 R7174 G1 225.01 Y 8 27453277 R192W C T missense Het probably benign 0.360 06/26/2019
41 558500 UTSW Prmt2 0.000 R7174 G1 225.01 Y 10 76225339 D104E G T missense Het probably benign 0.003 phenotype 06/26/2019
42 558518 UTSW Rgl2 0.127 R7174 G1 225.01 Y 17 33934990 F457L T C missense Het possibly damaging 0.929 0.304 06/26/2019
43 558492 UTSW Rlbp1 0.000 R7174 G1 225.01 Y 7 79377342 N190S T C missense Het possibly damaging 0.876 phenotype 06/26/2019
44 558507 UTSW Ryr2 1.000 R7174 G1 225.01 Y 13 11801177 D641G T C missense Het possibly damaging 0.808 phenotype 06/26/2019
45 558520 UTSW Sh3gl1 0.000 R7174 G1 225.01 Y 17 56017846 M303K A T missense Het probably benign 0.013 phenotype 06/26/2019
46 558480 UTSW Slc26a5 0.000 R7174 G1 225.01 Y 5 21813894 V649A A G missense Het probably damaging 0.998 phenotype 06/26/2019
47 558464 UTSW Slco4c1 0.181 R7174 G1 225.01 Y 1 96837598 N376D T C missense Het possibly damaging 0.869 phenotype 06/26/2019
48 558505 UTSW Socs3 1.000 R7174 G1 225.01 Y 11 117967727 Y168* A T nonsense Het probably null phenotype 06/26/2019
49 558508 UTSW Spata31d1d 0.000 R7174 G1 225.01 Y 13 59728580 N380K A T missense Het possibly damaging 0.719 0.067 06/26/2019
50 558476 UTSW Ssbp3 1.000 R7174 G1 225.01 Y 4 107037646 N254S A G missense Het probably benign 0.011 phenotype 06/26/2019
51 558494 UTSW Stard10 0.000 R7174 G1 225.01 Y 7 101346019 S326L C T missense Het probably damaging 0.963 phenotype 06/26/2019
52 558512 UTSW Taf2 1.000 R7174 G1 225.01 Y 15 55048739 D524G T C missense Het possibly damaging 0.514 phenotype 06/26/2019
53 558521 UTSW Taf7 1.000 R7174 G1 225.01 Y 18 37643000 S171R A T missense Het probably damaging 1.000 0.140 phenotype 06/26/2019
54 558471 UTSW Tchh 0.124 R7174 G1 225.01 Y 3 93446171 R973C C T missense Het unknown 06/26/2019
55 558472 UTSW Tmem67 1.000 R7174 G1 225.01 Y 4 12077337 R172G T C missense Het possibly damaging 0.818 phenotype 06/26/2019
56 558503 UTSW Top2a 0.965 R7174 G1 225.01 Y 11 99024096 C A start gained Het probably benign phenotype 06/26/2019
57 558506 UTSW Ttc8 0.385 R7174 G1 225.01 Y 12 98974701 N323K T A missense Het possibly damaging 0.792 phenotype 06/26/2019
58 558524 UTSW Txnl1 0.446 R7174 G1 225.01 Y 18 63671596 N276D T C missense Het probably benign 0.056 06/26/2019
59 568603 UTSW Usp24 0.000 R7174 G1 225.01 Y 4 106362681 T G splice site Het probably null phenotype 08/29/2019
60 568604 UTSW Vmn1r18 0.072 R7174 G1 225.01 Y 6 57389624 A C utr 3 prime Het probably null 08/29/2019
61 558488 UTSW Vmn2r53 0.106 R7174 G1 225.01 Y 7 12581701 H730Q A T missense Het probably benign 0.012 06/26/2019
62 558487 UTSW Wnk1 1.000 R7174 G1 225.01 Y 6 119970978 I500M A C missense Het probably damaging 0.999 0.016 phenotype 06/26/2019
63 558470 UTSW Zfp335 1.000 R7174 G1 225.01 Y 2 164902503 Y451N A T missense Het probably damaging 0.999 phenotype 06/26/2019
64 558478 UTSW Zfp683 0.165 R7174 G1 225.01 Y 4 134055753 I176N T A missense Het probably damaging 0.989 phenotype 06/26/2019
[records 1 to 64 of 64]