Incidental Mutations

76 incidental mutations are currently displayed, and affect 76 genes.
9 are Possibly Damaging.
30 are Probably Damaging.
27 are Probably Benign.
5 are Probably Null.
1 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 76 of 76] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 558864 UTSW Acot13 R7179 G1 225.01 Y 13 24818171 I96K A T missense Het probably benign 0.015 phenotype 06/26/2019
2 558862 UTSW Adam6a 0.063 R7179 G1 225.01 Y 12 113545671 T555A A G missense Het probably benign 0.023 06/26/2019
3 558831 UTSW Alms1 0.000 R7179 G1 225.01 Y 6 85621369 P1059L C T missense Het probably benign 0.085 phenotype 06/26/2019
4 558872 UTSW Apol7c 0.056 R7179 G1 225.01 Y 15 77525643 T368A T C missense Het probably benign 0.010 0.164 06/26/2019
5 558844 UTSW Arfgef3 0.146 R7179 G1 225.01 Y 10 18599267 L1557Q A T missense Het probably damaging 1.000 phenotype 06/26/2019
6 558851 UTSW Baz2a 0.000 R7179 G1 225.01 Y 10 128124457 R1514W C T missense Het probably damaging 0.984 06/26/2019
7 558829 UTSW Bmp3 0.000 R7179 G1 225.01 Y 5 98872763 D348E T A missense Het probably damaging 1.000 0.164 phenotype 06/26/2019
8 558848 UTSW Bves 0.000 R7179 G1 190.01 Y 10 45354817 S295G A G missense Het probably damaging 0.998 0.196 phenotype 06/26/2019
9 558863 UTSW Carmil1 0.000 R7179 G1 225.01 Y 13 24020069 C1328R A G missense Het probably benign 0.002 phenotype 06/26/2019
10 558861 UTSW Ccnk 1.000 R7179 G1 225.01 Y 12 108187258 Y93N T A missense Het probably damaging 1.000 phenotype 06/26/2019
11 558843 UTSW Ccr1 0.127 R7179 G1 225.01 Y 9 123964052 V147D A T missense Het probably damaging 0.998 phenotype 06/26/2019
12 558847 UTSW Cd24a 0.000 R7179 G1 225.01 Y 10 43582640 G36S G A missense Het probably benign 0.066 0.070 phenotype 06/26/2019
13 558828 UTSW Cep104 0.169 R7179 G1 225.01 Y 4 153992867 Y569C A G missense Het probably damaging 0.993 phenotype 06/26/2019
14 558834 UTSW Chd2 0.637 R7179 G1 225.01 Y 7 73475420 I884N A T missense Het probably damaging 1.000 phenotype 06/26/2019
15 558811 UTSW Cnst 0.103 R7179 G1 225.01 Y 1 179579382 A T start gained Het probably benign phenotype 06/26/2019
16 558871 UTSW Col22a1 0.000 R7179 G1 225.01 Y 15 71933413 L146P A G missense Het unknown 0.078 phenotype 06/26/2019
17 558825 UTSW Col25a1 0.122 R7179 G1 225.01 Y 3 130530119 R321L G T missense Het probably damaging 0.990 0.130 phenotype 06/26/2019
18 558870 UTSW Ctnnd2 0.000 R7179 G1 225.01 Y 15 30683364 Y504H T C missense Het possibly damaging 0.947 phenotype 06/26/2019
19 558821 UTSW D3Ertd751e 0.086 R7179 G1 225.01 Y 3 41748708 Q73K C A missense Het probably damaging 0.962 0.404 06/26/2019
20 558877 UTSW Dsc2 0.000 R7179 G1 225.01 Y 18 20035275 C T critical splice donor site 1 bp Het probably null phenotype 06/26/2019
21 558806 UTSW Eya1 0.902 R7179 G1 225.01 Y 1 14302852 S14R A T missense Het probably damaging 0.999 phenotype 06/26/2019
22 574573 UTSW Fam131c 0.051 R7179 G1 115.01 Y 4 141383017 A T intron 163 bp Het probably null 09/18/2019
23 558812 UTSW Fam71a 0.066 R7179 G1 225.01 Y 1 191164021 R142C G A missense Het probably damaging 1.000 phenotype 06/26/2019
24 558860 UTSW Flvcr2 0.813 R7179 G1 225.01 Y 12 85747191 F114L T C missense Het possibly damaging 0.943 0.110 phenotype 06/26/2019
25 558846 UTSW Fyn 1.000 R7179 G1 225.01 Y 10 39532124 D321G A G missense Het possibly damaging 0.905 0.284 phenotype 06/26/2019
26 558816 UTSW Galnt5 0.000 R7179 G1 225.01 Y 2 57998609 M74L A C missense Het probably benign 0.065 phenotype 06/26/2019
27 558854 UTSW Gas2l2 0.000 R7179 G1 225.01 Y 11 83422462 P675S G A missense Het probably benign 0.088 phenotype 06/26/2019
28 558849 UTSW Gm9508 R7179 G1 225.01 Y 10 77696636 Q200K G T missense Het unknown 0.370 06/26/2019
29 558876 UTSW Greb1l 1.000 R7179 G1 225.01 Y 18 10544576 S1390N G A missense Het probably benign 0.001 06/26/2019
30 558856 UTSW Hdac5 0.000 R7179 G1 225.01 Y 11 102204559 T430K G T missense Het possibly damaging 0.740 phenotype 06/26/2019
31 558810 UTSW Hjurp 0.899 R7179 G1 217.47 Y 1 88266278 TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT utr 3 prime Het probably benign 06/26/2019
32 558869 UTSW Khnyn 0.079 R7179 G1 225.01 Y 14 55894354 P578S C T missense Het probably damaging 1.000 phenotype 06/26/2019
33 558826 UTSW Lepr 0.000 R7179 G1 225.01 Y 4 101745659 T215S A T missense Het probably benign 0.062 phenotype 06/26/2019
34 558859 UTSW Lrfn5 0.083 R7179 G1 225.01 Y 12 61843982 V686I G A missense Het probably benign 0.000 0.088 phenotype 06/26/2019
35 558815 UTSW Mapkap1 1.000 R7179 G1 225.01 Y 2 34518700 H233Q T A missense Het possibly damaging 0.883 phenotype 06/26/2019
36 558807 UTSW Mcm3 1.000 R7179 G1 225.01 Y 1 20814857 I201T A G missense Het probably damaging 0.982 phenotype 06/26/2019
37 558857 UTSW Metrnl 0.000 R7179 G1 225.01 Y 11 121715908 R263Q G A missense Het probably damaging 0.987 06/26/2019
38 558873 UTSW Mettl22 0.000 R7179 G1 225.01 Y 16 8478060 E71G A G missense Het probably benign 0.002 phenotype 06/26/2019
39 558839 UTSW Muc16 0.164 R7179 G1 225.01 Y 9 18642008 T4330A T C missense Het probably benign 0.005 phenotype 06/26/2019
40 558832 UTSW Mug1 0.000 R7179 G1 211.01 Y 6 121857420 T387A A G missense Het probably benign 0.001 phenotype 06/26/2019
41 558853 UTSW Myh4 0.524 R7179 G1 225.01 Y 11 67244724 D379G A G missense Het probably benign 0.319 phenotype 06/26/2019
42 558858 UTSW Nbas 1.000 R7179 G1 225.01 Y 12 13405397 D1204G A G missense Het possibly damaging 0.944 phenotype 06/26/2019
43 558830 UTSW Ncor2 1.000 R7179 G1 225.01 Y 5 125055783 K478E T C missense Het unknown 0.236 phenotype 06/26/2019
44 558874 UTSW Olfr173 0.088 R7179 G1 225.01 Y 16 58796887 I320F T A missense Het probably benign 0.003 phenotype 06/26/2019
45 558835 UTSW Olfr294 0.094 R7179 G1 225.01 Y 7 86616366 L93Q A T missense Het possibly damaging 0.758 phenotype 06/26/2019
46 558836 UTSW Olfr557 0.095 R7179 G1 225.01 Y 7 102698270 T11A A G missense Het probably benign 0.001 phenotype 06/26/2019
47 558855 UTSW Osbpl7 0.234 R7179 G1 225.01 Y 11 97050836 V62I G A missense Het probably benign 0.050 phenotype 06/26/2019
48 558866 UTSW Pak1ip1 1.000 R7179 G1 225.01 Y 13 41009542 N246S A G missense Het probably damaging 0.966 phenotype 06/26/2019
49 558850 UTSW Prim1 0.952 R7179 G1 225.01 Y 10 128015976 Y39C A G missense Het probably damaging 0.999 phenotype 06/26/2019
50 558865 UTSW Prl3b1 0.073 R7179 G1 225.01 Y 13 27243844 V46L G T missense Het probably benign 0.055 06/26/2019
51 558838 UTSW Prss54 0.053 R7179 G1 225.01 Y 8 95565571 S127T A T missense Het probably benign 0.034 phenotype 06/26/2019
52 558875 UTSW Rasal3 0.062 R7179 G1 225.01 Y 17 32392417 T912M G A missense Het probably damaging 0.992 0.124 phenotype 06/26/2019
53 558878 UTSW Rrp12 0.942 R7179 G1 225.01 Y 19 41883778 T420S T A missense Het probably benign 0.028 06/26/2019
54 558827 UTSW Rspo1 0.000 R7179 G1 225.01 Y 4 125005038 N51D A G missense Het probably damaging 1.000 phenotype 06/26/2019
55 558809 UTSW Rufy4 0.260 R7179 G1 225.01 Y 1 74132876 R253G A G missense Het probably benign 0.119 06/26/2019
56 558833 UTSW Scaf1 0.933 R7179 G1 225.01 Y 7 45007743 R571C G A missense Het unknown 06/26/2019
57 558817 UTSW Scn2a 1.000 R7179 G1 225.01 Y 2 65701979 H645L A T missense Het probably damaging 0.996 phenotype 06/26/2019
58 558824 UTSW Sec24b 0.647 R7179 G1 225.01 Y 3 129988946 S1132P A G missense Het probably damaging 1.000 0.428 phenotype 06/26/2019
59 558819 UTSW Slc1a2 0.520 R7179 G1 225.01 Y 2 102755945 K298R A G missense Het probably damaging 1.000 phenotype 06/26/2019
60 558822 UTSW Slc25a54 0.254 R7179 G1 225.01 Y 3 109107257 N230K T A missense Het probably benign 0.001 06/26/2019
61 558814 UTSW Slc27a4 1.000 R7179 G1 225.01 Y 2 29815652 Y617* T G nonsense Het probably null phenotype 06/26/2019
62 558820 UTSW Slc2a10 0.084 R7179 G1 225.01 Y 2 165515349 S310P T C missense Het probably damaging 0.998 phenotype 06/26/2019
63 558840 UTSW Snx33 0.087 R7179 G1 225.01 Y 9 56925867 R306H C T missense Het probably damaging 1.000 0.022 phenotype 06/26/2019
64 574574 UTSW Spag9 0.797 R7179 G1 122.01 Y 11 94089432 A T intron Het probably null phenotype 09/18/2019
65 574572 UTSW Spg11 0.171 R7179 G1 225.01 Y 2 122101789 A T splice site Het probably null phenotype 09/18/2019
66 558867 UTSW Sycp2l 0.099 R7179 G1 225.01 Y 13 41129782 T165A A G missense Het probably damaging 0.998 phenotype 06/26/2019
67 558813 UTSW Syt14 0.000 R7179 G1 225.01 Y 1 192933263 C189R A G missense Het probably damaging 1.000 phenotype 06/26/2019
68 558845 UTSW Taar9 0.100 R7179 G1 225.01 Y 10 24108984 L184Q A T missense Het probably damaging 0.997 phenotype 06/26/2019
69 558868 UTSW Tkt 1.000 R7179 G1 183.01 Y 14 30559858 P111L C T missense Het probably damaging 1.000 phenotype 06/26/2019
70 558842 UTSW Trpc1 0.195 R7179 G1 225.01 Y 9 95721144 L445Q A T missense Het possibly damaging 0.818 phenotype 06/26/2019
71 558823 UTSW Usp53 0.159 R7179 G1 225.01 Y 3 122949710 S526P A G missense Het probably benign 0.012 phenotype 06/26/2019
72 558852 UTSW Vps54 0.936 R7179 G1 225.01 Y 11 21298791 W447G T G missense Het probably damaging 1.000 phenotype 06/26/2019
73 558818 UTSW Xirp2 0.329 R7179 G1 225.01 Y 2 67509833 H806L A T missense Het probably benign 0.001 phenotype 06/26/2019
74 558808 UTSW Zfp451 0.000 R7179 G1 225.01 Y 1 33802570 H410Q A T missense Het unknown 06/26/2019
75 558837 UTSW Zfp688 0.114 R7179 G1 225.01 Y 7 127419312 C214R A G missense Het probably damaging 1.000 06/26/2019
76 558841 UTSW Zic4 0.192 R7179 G1 225.01 Y 9 91379121 D143G A G missense Het possibly damaging 0.888 phenotype 06/26/2019
[records 1 to 76 of 76]