Incidental Mutations

65 incidental mutations are currently displayed, and affect 65 genes.
17 are Possibly Damaging.
19 are Probably Damaging.
20 are Probably Benign.
6 are Probably Null.
5 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 65 of 65] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 559148 UTSW 2310007B03Rik 0.000 R7184 G1 225.01 Y 1 93154515 N294S T C missense Het probably benign 0.002 06/26/2019
2 559173 UTSW Aass 0.000 R7184 G1 225.01 Y 6 23094220 S500P A G missense Het possibly damaging 0.554 phenotype 06/26/2019
3 559152 UTSW Aldh9a1 0.000 R7184 G1 225.01 Y 1 167357396 N292K T A missense Het probably benign 0.052 phenotype 06/26/2019
4 559182 UTSW Art2b 0.056 R7184 G1 225.01 Y 7 101580451 S80R A T missense Het probably benign 0.168 0.144 06/26/2019
5 559184 UTSW Atp6v1b2 1.000 R7184 G1 225.01 Y 8 69102567 A194S G T missense Het possibly damaging 0.554 phenotype 06/26/2019
6 559167 UTSW Bsnd 0.063 R7184 G1 225.01 Y 4 106491912 M44V T C missense Het probably damaging 0.995 phenotype 06/26/2019
7 559175 UTSW Cadps2 0.000 R7184 G1 225.01 Y 6 23583429 V383E A T missense Het probably benign 0.180 phenotype 06/26/2019
8 559157 UTSW Cd93 0.063 R7184 G1 225.01 Y 2 148442539 T296A T C missense Het possibly damaging 0.757 phenotype 06/26/2019
9 559145 UTSW Cdk15 0.000 R7184 G1 225.01 Y 1 59265655 E138D G T missense Het probably benign 0.333 06/26/2019
10 559189 UTSW Cdon 0.348 R7184 G1 225.01 Y 9 35463895 I406V A G missense Het probably benign 0.149 0.042 phenotype 06/26/2019
11 559172 UTSW Cyp3a41a 0.184 R7184 G1 225.01 Y 5 145705853 V232A A G missense Het probably benign 0.009 0.142 06/26/2019
12 559187 UTSW Dbndd1 0.067 R7184 G1 225.01 Y 8 123509121 D130V T A missense Het probably damaging 1.000 06/26/2019
13 559153 UTSW Dnah14 0.081 R7184 G1 225.01 Y 1 181704529 R2294* C T nonsense Het probably null phenotype 06/26/2019
14 559198 UTSW Eddm3b 0.000 R7184 G1 225.01 Y 14 51116930 Y125C A G missense Het probably damaging 1.000 phenotype 06/26/2019
15 559154 UTSW Enah 0.872 R7184 G1 225.01 Y 1 181922392 V294E A T missense Het probably damaging 0.989 phenotype 06/26/2019
16 559149 UTSW Farp2 0.000 R7184 G1 225.01 Y 1 93603415 E545G A G missense Het probably damaging 1.000 phenotype 06/26/2019
17 559147 UTSW Farsb 0.968 R7184 G1 225.01 Y 1 78482357 E22G T C missense Het possibly damaging 0.860 phenotype 06/26/2019
18 559174 UTSW Fezf1 1.000 R7184 G1 225.01 Y 6 23247836 V80A A G missense Het probably benign 0.312 phenotype 06/26/2019
19 559201 UTSW Fpr2 0.082 R7184 G1 225.01 Y 17 17893271 Y39H T C missense Het unknown phenotype 06/26/2019
20 559166 UTSW Fsd1l 0.549 R7184 G1 225.01 Y 4 53694054 R344S C A missense Het probably damaging 1.000 06/26/2019
21 559186 UTSW Fuk 0.164 R7184 G1 225.01 Y 8 110887156 P758S G A missense Het probably damaging 0.999 phenotype 06/26/2019
22 559181 UTSW Fxyd1 0.000 R7184 G1 225.01 Y 7 31051976 R90S G T missense Het unknown phenotype 06/26/2019
23 559190 UTSW Galnt4 0.000 R7184 G1 225.01 Y 10 99108604 Y64N T A missense Het probably damaging 1.000 0.208 phenotype 06/26/2019
24 559160 UTSW Gatb 0.957 R7184 G1 225.01 Y 3 85636951 Q409* C T nonsense Het probably null 0.504 06/26/2019
25 559165 UTSW Glipr2 0.228 R7184 G1 225.01 Y 4 43968667 D73A A C missense Het possibly damaging 0.610 06/26/2019
26 559194 UTSW Gm2035 0.257 R7184 G1 225.01 Y 12 87919722 R46W G A missense Het possibly damaging 0.493 0.068 06/26/2019
27 559183 UTSW Gm40460 R7184 G1 146.49 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG small deletion Het probably benign 06/26/2019
28 559150 UTSW Gm4788 0.077 R7184 G1 225.01 Y 1 139733084 V622A A G missense Het possibly damaging 0.647 06/26/2019
29 559162 UTSW Gpr88 0.109 R7184 G1 111.01 Y 3 116251994 V223I C T missense Het possibly damaging 0.511 06/26/2019
30 559171 UTSW Gtf2h3 0.955 R7184 G1 225.01 Y 5 124584004 N55S A G missense Het probably benign 0.225 phenotype 06/26/2019
31 559204 UTSW Htr4 0.000 R7184 G1 225.01 Y 18 62437427 C184* T A nonsense Het probably null phenotype 06/26/2019
32 559195 UTSW Ighv6-3 0.080 R7184 G1 225.01 Y 12 114391855 R71S T A missense Het probably benign 0.039 06/26/2019
33 559178 UTSW Itpr2 0.000 R7184 G1 225.01 Y 6 146311087 I1510M G C missense Het possibly damaging 0.788 phenotype 06/26/2019
34 559188 UTSW Keap1 0.962 R7184 G1 209.01 Y 9 21233838 Q292R T C missense Het probably benign 0.000 phenotype 06/26/2019
35 559205 UTSW Malt1 0.322 R7184 G1 225.01 Y 18 65447693 E219D A C missense Het probably benign 0.000 phenotype 06/26/2019
36 559164 UTSW Manba 0.086 R7184 G1 225.01 Y 3 135523154 V279A T C missense Het possibly damaging 0.620 0.200 phenotype 06/26/2019
37 559193 UTSW Map4k5 0.000 R7184 G1 225.01 Y 12 69874321 H41L T A missense Het probably benign 0.002 phenotype 06/26/2019
38 559177 UTSW Mcm2 1.000 R7184 G1 225.01 Y 6 88891794 Y327S T G missense Het probably damaging 0.998 phenotype 06/26/2019
39 559200 UTSW Nectin3 0.340 R7184 G1 225.01 Y 16 46395121 I503T A G missense Het possibly damaging 0.656 phenotype 06/26/2019
40 559185 UTSW Nqo1 0.097 R7184 G1 182.01 Y 8 107392647 I99M T C missense Het probably damaging 1.000 phenotype 06/26/2019
41 559206 UTSW Nrxn2 0.000 R7184 G1 225.01 Y 19 6490552 H845R A G missense Het probably damaging 1.000 phenotype 06/26/2019
42 559191 UTSW Otogl 0.000 R7184 G1 225.01 Y 10 107763200 C2254Y C T missense Het probably damaging 1.000 phenotype 06/26/2019
43 559199 UTSW Pmm1 0.000 R7184 G1 225.01 Y 15 81956214 N110S T C missense Het probably damaging 1.000 phenotype 06/26/2019
44 568568 UTSW Poc1b 0.000 R7184 G1 215.01 Y 10 99134337 C68F G T missense Het probably benign 0.008 0.133 phenotype 08/23/2019
45 559156 UTSW Polr1b 1.000 R7184 G1 225.01 Y 2 129123922 Y828C A G missense Het possibly damaging 0.942 0.324 phenotype 06/26/2019
46 559196 UTSW Prl3d1 0.091 R7184 G1 225.01 Y 13 27098636 H119R A G missense Het probably damaging 0.997 06/26/2019
47 559207 UTSW Pum3 0.908 R7184 G1 225.01 Y 19 27426012 S30P A G missense Het probably benign 0.027 phenotype 06/26/2019
48 559202 UTSW Rgl2 0.137 R7184 G1 218.01 Y 17 33934990 F457L T C missense Het possibly damaging 0.929 0.304 06/26/2019
49 559161 UTSW Rusc1 0.000 R7184 G1 225.01 Y 3 89091887 E196G T C missense Het possibly damaging 0.608 06/26/2019
50 559168 UTSW Sf3a3 0.965 R7184 G1 225.01 Y 4 124714979 K29E A G missense Het probably benign 0.096 phenotype 06/26/2019
51 559176 UTSW Slc13a1 0.084 R7184 G1 225.01 Y 6 24092312 I475K A T missense Het probably damaging 0.992 phenotype 06/26/2019
52 559169 UTSW Slc26a5 0.000 R7184 G1 225.01 Y 5 21837246 Y237* G T nonsense Het probably null phenotype 06/26/2019
53 559159 UTSW Slc7a14 0.141 R7184 G1 225.01 Y 3 31227063 G366D C T missense Het probably damaging 0.975 phenotype 06/26/2019
54 559203 UTSW Tbc1d5 0.000 R7184 G1 225.01 Y 17 50800082 V482A A G missense Het probably benign 0.001 06/26/2019
55 559151 UTSW Tdrd5 0.226 R7184 G1 225.01 Y 1 156259935 Q883K G T missense Het probably benign 0.301 phenotype 06/26/2019
56 559163 UTSW Tet2 1.000 R7184 G1 225.01 Y 3 133473630 Y1258C T C missense Het probably damaging 0.979 phenotype 06/26/2019
57 559155 UTSW Upf2 1.000 R7184 G1 225.01 Y 2 6023320 D739G A G missense Het unknown 0.334 phenotype 06/26/2019
58 559180 UTSW Vmn1r122 R7184 G1 225.01 N 7 21133895 F78L A T missense Het probably benign 0.140 06/26/2019
59 559179 UTSW Vmn1r75 0.055 R7184 G1 225.01 Y 7 11880988 K216* A T nonsense Het probably null 06/26/2019
60 559170 UTSW Vmn2r11 0.090 R7184 G1 225.01 Y 5 109053415 Y408N A T missense Het probably damaging 1.000 06/26/2019
61 559192 UTSW Wscd1 0.000 R7184 G1 225.01 Y 11 71788717 V472D T A missense Het probably damaging 1.000 06/26/2019
62 559146 UTSW Zdbf2 0.096 R7184 G1 225.01 Y 1 63306505 V1348F G T missense Het possibly damaging 0.915 phenotype 06/26/2019
63 559158 UTSW Zfp442 0.077 R7184 G1 225.01 Y 2 150408136 H615Q G T missense Het possibly damaging 0.711 06/26/2019
64 559197 UTSW Zfp457 0.095 R7184 G1 225.01 Y 13 67294001 C170F C A missense Het possibly damaging 0.690 06/26/2019
65 568569 UTSW Zscan10 0.245 R7184 G1 143.01 Y 17 23607029 A G intron Het probably null phenotype 08/23/2019
[records 1 to 65 of 65]