Incidental Mutations

82 incidental mutations are currently displayed, and affect 81 genes.
14 are Possibly Damaging.
24 are Probably Damaging.
26 are Probably Benign.
16 are Probably Null.
8 create premature stop codons.
1 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 82 of 82] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 560320 UTSW 4932415D10Rik 0.078 R7201 G1 225.01 Y 10 82291627 M1850V T C missense Het probably benign 0.026 06/26/2019
2 560268 UTSW 4933406M09Rik 0.000 R7201 G1 225.01 Y 1 134390468 D326G A G missense Het possibly damaging 0.688 06/26/2019
3 560325 UTSW Acaca 1.000 R7201 G1 225.01 Y 11 84262474 T903A A G missense Het probably benign 0.411 phenotype 06/26/2019
4 560332 UTSW Acin1 0.943 R7201 G1 225.01 Y 14 54664899 S479T A T missense Het possibly damaging 0.835 0.084 phenotype 06/26/2019
5 560321 UTSW Actr6 1.000 R7201 G1 225.01 Y 10 89712512 D370E A T missense Het probably benign 0.103 06/26/2019
6 560291 UTSW Adgrl3 0.000 R7201 G1 225.01 Y 5 81724222 F921S T C missense Het probably damaging 1.000 phenotype 06/26/2019
7 560267 UTSW Ankmy1 0.068 R7201 G1 225.01 Y 1 92886824 H320Q A T missense Het possibly damaging 0.946 06/26/2019
8 560297 UTSW Arhgef5 0.000 R7201 G1 225.01 Y 6 43273232 Q306* C T nonsense Het probably null phenotype 06/26/2019
9 560309 UTSW Arntl 0.674 R7201 G1 225.01 Y 7 113285142 M122K T A missense Het probably damaging 0.995 phenotype 06/26/2019
10 560301 UTSW Art4 0.000 R7201 G1 225.01 Y 6 136854549 V198E A T missense Het probably benign 0.003 phenotype 06/26/2019
11 560282 UTSW Asph 0.000 R7201 G1 225.01 Y 4 9474917 R686W G A missense Het probably damaging 1.000 phenotype 06/26/2019
12 560299 UTSW Atg7 1.000 R7201 G1 225.01 Y 6 114777057 H724R A G missense Het probably damaging 0.998 phenotype 06/26/2019
13 560285 UTSW B020004J07Rik 0.000 R7201 G1 225.01 Y 4 101838141 T A critical splice acceptor site Het probably null 06/26/2019
14 560269 UTSW BC034090 0.066 R7201 G1 225.01 Y 1 155241934 V146A A G missense Het probably damaging 0.977 06/26/2019
15 560315 UTSW Bcl2a1d 0.166 R7201 G1 225.01 Y 9 88731586 Q45L T A missense Het probably damaging 1.000 06/26/2019
16 560316 UTSW Ccdc36 0.091 R7201 G1 225.01 Y 9 108404775 D571E A T missense Het probably damaging 0.983 06/26/2019
17 560266 UTSW Cd28 0.187 R7201 G1 225.01 Y 1 60763173 E84* G T nonsense Het probably null phenotype 06/26/2019
18 560302 UTSW Ceacam3 0.000 R7201 G1 225.01 Y 7 17158238 W302* G A nonsense Het probably null 0.592 06/26/2019
19 560274 UTSW Cerkl 0.260 R7201 G1 225.01 Y 2 79333590 N462S T C missense Het probably benign 0.001 phenotype 06/26/2019
20 560281 UTSW Cisd2 0.165 R7201 G1 225.01 Y 3 135411213 L39H A T missense Het probably damaging 1.000 phenotype 06/26/2019
21 560279 UTSW Col11a1 0.839 R7201 G1 225.01 Y 3 114090157 T225K C A missense Het unknown phenotype 06/26/2019
22 560283 UTSW Col15a1 0.077 R7201 G1 225.01 Y 4 47307752 Y1178F A T missense Het possibly damaging 0.915 phenotype 06/26/2019
23 560310 UTSW Cul4a 0.397 R7201 G1 225.01 Y 8 13142991 S630P T C missense Het probably damaging 0.979 phenotype 06/26/2019
24 560341 UTSW Cyp2c38 0.106 R7201 G1 225.01 Y 19 39401776 I327F T A missense Het probably damaging 1.000 0.328 06/26/2019
25 560294 UTSW Cyp3a25 0.082 R7201 G1 225.01 Y 5 145991447 S263A A C missense Het probably benign 0.218 06/26/2019
26 560295 UTSW Cyp3a25 0.082 R7201 G1 225.01 Y 5 146003058 L46F T A missense Het probably benign 0.001 06/26/2019
27 574653 UTSW D17Wsu92e 0.000 R7201 G1 225.01 Y 17 27794070 A C splice site Het probably null 09/27/2019
28 560284 UTSW Dmrta1 0.000 R7201 G1 225.01 Y 4 89692171 L456* T A nonsense Het probably null phenotype 06/26/2019
29 560331 UTSW Dnah12 0.232 R7201 G1 225.01 Y 14 26814622 L2165P T C missense Het probably benign 0.076 06/26/2019
30 560339 UTSW Dsg1a 0.076 R7201 G1 225.01 Y 18 20328311 S253R C A missense Het probably damaging 0.977 phenotype 06/26/2019
31 560304 UTSW Egln2 0.000 R7201 G1 225.01 Y 7 27160319 I323S A C missense Het probably damaging 1.000 phenotype 06/26/2019
32 560275 UTSW Fam171b 0.104 R7201 G1 225.01 Y 2 83878230 T359A A G missense Het probably damaging 1.000 06/26/2019
33 560270 UTSW Fcgr2b 0.063 R7201 G1 225.01 Y 1 170963397 Q276K G T missense Het probably benign 0.000 phenotype 06/26/2019
34 560277 UTSW Fcrls 0.056 R7201 G1 225.01 Y 3 87252627 C440Y C T missense Het probably damaging 0.994 phenotype 06/26/2019
35 560273 UTSW Fmnl2 0.000 R7201 G1 225.01 Y 2 53073654 V266A T C missense Het unknown phenotype 06/26/2019
36 560337 UTSW Glo1 R7201 G1 225.01 Y 17 30597854 D109E A T missense Het probably benign 0.000 phenotype 06/26/2019
37 560319 UTSW Grin3b 0.000 R7201 G1 225.01 Y 10 79974078 R473G A G missense Het possibly damaging 0.956 phenotype 06/26/2019
38 560296 UTSW Ica1 0.191 R7201 G1 225.01 Y 6 8644015 L425F G A missense Het probably damaging 0.999 phenotype 06/26/2019
39 560265 UTSW Kcnq5 0.383 R7201 G1 225.01 Y 1 21402875 E716G T C missense Het possibly damaging 0.928 phenotype 06/26/2019
40 560300 UTSW Klra17 0.053 R7201 G1 225.01 Y 6 129873343 I48K A T missense Het possibly damaging 0.618 phenotype 06/26/2019
41 560290 UTSW Lrrc66 0.050 R7201 G1 225.01 Y 5 73629897 Q37K G T missense Het probably benign 0.109 06/26/2019
42 560335 UTSW Ly6a 0.075 R7201 G1 225.01 Y 15 74996476 T55S T A missense Het probably benign 0.011 phenotype 06/26/2019
43 560328 UTSW Lyst 0.423 R7201 G1 225.01 Y 13 13709300 Y2924* T A nonsense Het probably null phenotype 06/26/2019
44 560327 UTSW Lyzl6 0.070 R7201 G1 225.01 Y 11 103631351 Y140H A G missense Het probably benign 0.002 phenotype 06/26/2019
45 560329 UTSW Mak 0.771 R7201 G1 225.01 Y 13 41051440 I141V T C missense Het possibly damaging 0.941 phenotype 06/26/2019
46 560323 UTSW Mapk7 1.000 R7201 G1 225.01 Y 11 61489172 I789T A G missense Het probably benign 0.332 phenotype 06/26/2019
47 560312 UTSW Mrpl4 0.961 R7201 G1 225.01 Y 9 21007338 I123T T C missense Het probably benign 0.026 phenotype 06/26/2019
48 574650 UTSW Mup18 0.065 R7201 G1 175.01 N 4 61673336 G C intron 119 bp Het probably null 09/27/2019
49 574649 UTSW Myef2 0.183 R7201 G1 225.01 Y 2 125096162 T C intron Het probably null 09/27/2019
50 560333 UTSW Myh7 0.812 R7201 G1 225.01 Y 14 54990945 T235A T C missense Het possibly damaging 0.580 0.384 phenotype 06/26/2019
51 560292 UTSW Myo18b 1.000 R7201 G1 225.01 Y 5 112715459 C2171Y C T missense Het probably damaging 0.998 phenotype 06/26/2019
52 560298 UTSW Nat8 0.100 R7201 G1 225.01 Y 6 85830895 Y85* A T nonsense Het probably null phenotype 06/26/2019
53 560293 UTSW Nyap1 0.135 R7201 G1 225.01 Y 5 137736262 S170T A T missense Het probably damaging 0.999 phenotype 06/26/2019
54 560276 UTSW Ogfr 0.186 R7201 G1 217.47 N 2 180595094 AGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG unclassified Het probably benign phenotype 06/26/2019
55 560324 UTSW Olfr392 0.000 R7201 G1 225.01 Y 11 73814341 V247A A G missense Het probably benign 0.189 phenotype 06/26/2019
56 560307 UTSW Olfr559 0.092 R7201 G1 225.01 Y 7 102724485 I2F T A missense Het probably benign 0.000 phenotype 06/26/2019
57 574651 UTSW Olfr718-ps1 0.126 R7201 G1 77.01 Y 5 143137798 Y157H A G missense Het probably damaging 1.000 09/27/2019
58 560280 UTSW Papss1 0.504 R7201 G1 225.01 Y 3 131599926 L244P T C missense Het probably damaging 1.000 phenotype 06/26/2019
59 560334 UTSW Pibf1 1.000 R7201 G1 225.01 Y 14 99196408 D597V A T missense Het probably damaging 0.990 06/26/2019
60 560287 UTSW Pmpcb 1.000 R7201 G1 225.01 Y 5 21737179 M1K T A start codon destroyed Het probably null 0.021 phenotype 06/26/2019
61 560330 UTSW Ppwd1 0.943 R7201 G1 225.01 Y 13 104207172 P575L G A missense Het probably damaging 1.000 06/26/2019
62 560306 UTSW Prc1 1.000 R7201 G1 225.01 Y 7 80311089 Q457R A G missense Het possibly damaging 0.652 0.236 phenotype 06/26/2019
63 560313 UTSW Prdm10 1.000 R7201 G1 225.01 Y 9 31316306 V69A T C missense Het possibly damaging 0.872 phenotype 06/26/2019
64 560336 UTSW Prkdc 0.963 R7201 G1 225.01 Y 16 15698803 I1014V A G missense Het probably benign 0.120 phenotype 06/26/2019
65 560271 UTSW Rab3gap2 0.000 R7201 G1 225.01 Y 1 185267191 Y999C A G missense Het probably damaging 0.995 phenotype 06/26/2019
66 560314 UTSW Robo3 1.000 R7201 G1 225.01 Y 9 37424330 Q539* G A nonsense Het probably null phenotype 06/26/2019
67 560317 UTSW Rps12 1.000 R7201 G1 225.01 Y 10 23785231 Y127H A G missense Het probably benign 0.014 0.132 phenotype 06/26/2019
68 560322 UTSW Sar1b R7201 G1 225.01 Y 11 51788252 D116G A G missense Het probably benign 0.098 phenotype 06/26/2019
69 560278 UTSW Selenbp2 0.432 R7201 G1 225.01 Y 3 94702357 P294L C T missense Het probably benign 0.032 06/26/2019
70 560311 UTSW Slc6a2 0.205 R7201 G1 225.01 Y 8 92995672 Y516H T C missense Het probably damaging 1.000 phenotype 06/26/2019
71 560289 UTSW Slit2 1.000 R7201 G1 225.01 Y 5 48237285 N673S A G missense Het probably null 0.846 phenotype 06/26/2019
72 574652 UTSW Snap91 0.881 R7201 G1 225.01 Y 9 86790146 A T splice site Het probably null phenotype 09/27/2019
73 560288 UTSW Srpk2 0.000 R7201 G1 225.01 Y 5 23507628 F653L A G missense Het possibly damaging 0.637 phenotype 06/26/2019
74 560305 UTSW Supt5 1.000 R7201 G1 225.01 Y 7 28316788 S824T A T missense Het probably benign 0.028 06/26/2019
75 560318 UTSW Taar7a 0.116 R7201 G1 225.01 Y 10 23992460 V341A A G missense Het probably benign 0.035 0.142 06/26/2019
76 560286 UTSW Tmem52 0.054 R7201 G1 225.01 Y 4 155470321 G134R G A missense Het probably damaging 1.000 06/26/2019
77 560272 UTSW Ush2a 0.615 R7201 G1 225.01 Y 1 188874754 T3949A A G missense Het probably benign 0.000 phenotype 06/26/2019
78 560326 UTSW Usp32 1.000 R7201 G1 217.47 Y 11 85022855 GAACAAGTCCACAACAA GAACAA frame shift Het probably null 06/26/2019
79 560303 UTSW Vmn1r173 0.363 R7201 G1 189.01 Y 7 23702158 A T start gained Het probably benign 0.134 06/26/2019
80 560338 UTSW Vmn2r118 0.134 R7201 G1 225.01 Y 17 55608496 R485* G A nonsense Het probably null 06/26/2019
81 560340 UTSW Vwce 0.061 R7201 G1 225.01 Y 19 10638115 E120G A G missense Het possibly damaging 0.719 06/26/2019
82 560308 UTSW Zfp143 0.936 R7201 G1 225.01 Y 7 110093080 V566A T C missense Het possibly damaging 0.740 phenotype 06/26/2019
[records 1 to 82 of 82]