Incidental Mutations

75 incidental mutations are currently displayed, and affect 74 genes.
11 are Possibly Damaging.
28 are Probably Damaging.
21 are Probably Benign.
11 are Probably Null.
8 create premature stop codons.
3 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 75 of 75] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 566712 UTSW Abca2 0.000 R7297 G1 225.01 N 2 25442076 D1400G A G missense Het probably benign 0.001 phenotype 06/26/2019
2 566757 UTSW Abca6 0.000 R7297 G1 225.01 N 11 110183026 C T critical splice donor site 1 bp Het probably null phenotype 06/26/2019
3 566719 UTSW Adh4 0.107 R7297 G1 225.01 N 3 138429140 I358M A G missense Het possibly damaging 0.884 phenotype 06/26/2019
4 566760 UTSW Akap6 0.739 R7297 G1 225.01 N 12 52887364 D546E T G missense Het probably benign 0.024 phenotype 06/26/2019
5 566778 UTSW Arap3 0.661 R7297 G1 225.01 N 18 37973563 A1409V G A missense Het possibly damaging 0.805 phenotype 06/26/2019
6 566766 UTSW Arhgap22 0.000 R7297 G1 225.01 N 14 33271933 R68* C T nonsense Het probably null phenotype 06/26/2019
7 566706 UTSW Arhgef4 0.000 R7297 G1 225.01 N 1 34807192 D207V A T missense Het probably damaging 0.995 phenotype 06/26/2019
8 566729 UTSW Asb15 0.000 R7297 G1 225.01 N 6 24566463 T472A A G missense Het probably damaging 0.961 phenotype 06/26/2019
9 566749 UTSW Ascl1 1.000 R7297 G1 225.01 N 10 87492464 S209T A T missense Het probably damaging 1.000 phenotype 06/26/2019
10 566717 UTSW Asxl1 1.000 R7297 G1 225.01 N 2 153397435 V382A T C missense Het probably benign 0.009 phenotype 06/26/2019
11 566740 UTSW Atp11a 1.000 R7297 G1 225.01 N 8 12806774 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
12 566730 UTSW Calu 0.483 R7297 G1 225.01 N 6 29356555 R27* C T nonsense Het probably null phenotype 06/26/2019
13 566707 UTSW Cdh20 0.233 R7297 G1 225.01 N 1 104970873 T442A A G missense Het probably benign 0.000 phenotype 06/26/2019
14 566761 UTSW Chrm3 0.651 R7297 G1 225.01 N 13 9877833 Q389L T A missense Het probably benign 0.011 phenotype 06/26/2019
15 566755 UTSW Cntnap1 0.590 R7297 G1 225.01 N 11 101188634 T1233A A G missense Het probably benign 0.012 phenotype 06/26/2019
16 566743 UTSW Cwc15 0.302 R7297 G1 225.01 N 9 14510229 C197Y G A missense Het probably damaging 0.998 06/26/2019
17 566732 UTSW D6Ertd527e 0.098 R7297 G1 225.01 N 6 87111524 T223S C G missense Het unknown 0.049 06/26/2019
18 566769 UTSW Dennd3 0.164 R7297 G1 225.01 N 15 73557610 T914I C T missense Het probably damaging 0.999 06/26/2019
19 566754 UTSW Dlx3 R7297 G1 225.01 N 11 95120450 Y43* C A nonsense Het probably null phenotype 06/26/2019
20 566758 UTSW Dnah17 0.000 R7297 G1 225.01 N 11 118055730 A T critical splice donor site 2 bp Het probably null phenotype 06/26/2019
21 566759 UTSW Dnah17 0.000 R7297 G1 225.01 N 11 118103356 F1081S A G missense Het probably damaging 0.977 phenotype 06/26/2019
22 566710 UTSW Dpp10 0.000 R7297 G1 225.01 N 1 123353428 Q631* G A nonsense Het probably null phenotype 06/26/2019
23 566708 UTSW Dsel 0.121 R7297 G1 225.01 N 1 111861776 D343V T A missense Het probably damaging 1.000 phenotype 06/26/2019
24 566734 UTSW Efcab12 0.090 R7297 G1 225.01 N 6 115811036 D655G T C missense Het possibly damaging 0.852 06/26/2019
25 566723 UTSW Epha8 0.000 R7297 G1 225.01 N 4 136945913 I187L T A missense Het probably damaging 0.996 phenotype 06/26/2019
26 566724 UTSW Exosc10 0.966 R7297 G1 225.01 N 4 148580377 K781E A G missense Het probably damaging 0.999 phenotype 06/26/2019
27 566737 UTSW Exosc5 0.948 R7297 G1 225.01 N 7 25666326 L200P T C missense Het probably benign 0.001 06/26/2019
28 566745 UTSW Faiml 0.421 R7297 G1 225.01 N 9 99229613 E131G T C missense Het probably damaging 0.977 06/26/2019
29 566713 UTSW Gm13723 R7297 G1 128.01 N 2 86873636 V29E A T missense Het probably damaging 0.960 06/26/2019
30 566775 UTSW Gm5145 0.926 R7297 G1 225.01 N 17 20570731 V124I G A missense Het probably benign 0.004 06/26/2019
31 566733 UTSW Grm7 0.000 R7297 G1 225.01 N 6 110646013 V49A T C missense Het probably benign 0.162 phenotype 06/26/2019
32 566772 UTSW Gtf2e1 0.947 R7297 G1 225.01 N 16 37536065 D35G T C missense Het probably damaging 1.000 06/26/2019
33 566762 UTSW Heatr1 0.968 R7297 G1 225.01 N 13 12421060 Q1160* C T nonsense Het probably null 06/26/2019
34 566739 UTSW Herc2 0.958 R7297 G1 225.01 N 7 56136658 C1584S T A missense Het probably benign 0.002 phenotype 06/26/2019
35 566765 UTSW Hsd17b3 0.000 R7297 G1 225.01 N 13 64076351 I88V T C missense Het probably damaging 0.998 phenotype 06/26/2019
36 566711 UTSW Hspa14 0.197 R7297 G1 225.01 N 2 3498142 L205R A C missense Het possibly damaging 0.758 06/26/2019
37 566720 UTSW Ifna11 0.058 R7297 G1 225.01 N 4 88820425 E156A A C missense Het possibly damaging 0.861 06/26/2019
38 566771 UTSW Krt83 0.092 R7297 G1 225.01 N 15 101489647 D170G T C missense Het probably benign 0.417 06/26/2019
39 566773 UTSW Mas1 0.000 R7297 G1 225.01 N 17 12841858 Y226C T C missense Het probably damaging 0.997 phenotype 06/26/2019
40 566770 UTSW Micall1 0.092 R7297 G1 225.01 N 15 79120897 F190L T C missense Het unknown 06/26/2019
41 566753 UTSW Msi2 1.000 R7297 G1 225.01 N 11 88480038 L141Q A T missense Het probably damaging 0.971 phenotype 06/26/2019
42 566738 UTSW Nfkbib 0.135 R7297 G1 225.01 N 7 28766343 D27G T C missense Het probably benign 0.067 phenotype 06/26/2019
43 566736 UTSW Nlrp9b 0.000 R7297 G1 225.01 N 7 20049513 D927G A G missense Het possibly damaging 0.811 phenotype 06/26/2019
44 566767 UTSW Nrg3 0.170 R7297 G1 225.01 N 14 38370939 D579G T C missense Het probably benign 0.097 phenotype 06/26/2019
45 566714 UTSW Nutm1 0.000 R7297 G1 225.01 N 2 112250056 R505C G A missense Het probably damaging 0.975 0.028 06/26/2019
46 566744 UTSW Olfr26 0.068 R7297 G1 225.01 N 9 38855949 D296N G A missense Het probably damaging 0.999 phenotype 06/26/2019
47 566768 UTSW Parp4 0.137 R7297 G1 225.01 N 14 56647681 P1406S C T missense Het not run phenotype 06/26/2019
48 566747 UTSW Pkib 0.000 R7297 G1 225.01 N 10 57736326 Q101L A T missense Het possibly damaging 0.899 phenotype 06/26/2019
49 566741 UTSW Plat 0.000 R7297 G1 225.01 N 8 22775697 T252I C T missense Het probably benign 0.117 phenotype 06/26/2019
50 566752 UTSW Ppm1d 1.000 R7297 G1 225.01 N 11 85345995 E533D A T missense Het probably damaging 0.999 phenotype 06/26/2019
51 566742 UTSW Psd3 0.100 R7297 G1 225.01 N 8 68121034 K165R T C missense Het probably damaging 0.977 06/26/2019
52 566735 UTSW Psg29 0.059 R7297 G1 225.01 N 7 17210691 Y375* T A nonsense Het probably null 06/26/2019
53 566725 UTSW Pus7 0.352 R7297 G1 225.01 N 5 23741910 I644N A T missense Het probably damaging 0.998 06/26/2019
54 566716 UTSW Rbbp9 0.105 R7297 G1 219.01 N 2 144543802 M181K A T missense Het probably benign 0.000 phenotype 06/26/2019
55 566726 UTSW Rell1 0.082 R7297 G1 225.01 N 5 63936075 N112K A T missense Het possibly damaging 0.858 06/26/2019
56 566763 UTSW Simc1 0.077 R7297 G1 127.47 N 13 54525235 AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG AATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAGATGTGATGCAGTCACCAAGAG intron Het probably benign 06/26/2019
57 566721 UTSW Skint5 0.070 R7297 G1 225.01 N 4 113542934 T1184M G A missense Het unknown 06/26/2019
58 566715 UTSW Slc27a2 0.000 R7297 G1 225.01 N 2 126578946 D452E T A missense Het probably damaging 0.989 phenotype 06/26/2019
59 566777 UTSW Slc44a4 0.000 R7297 G1 225.01 N 17 34927912 I489N T A missense Het probably damaging 0.982 phenotype 06/26/2019
60 566751 UTSW Slfn14 0.113 R7297 G1 225.01 N 11 83278995 K608* T A nonsense Het probably null phenotype 06/26/2019
61 566779 UTSW Snx15 0.000 R7297 G1 225.01 N 19 6120507 I301F T A missense Het probably damaging 0.997 phenotype 06/26/2019
62 566756 UTSW Sost 0.127 R7297 G1 81.01 N 11 101964103 G127R C T missense Het probably damaging 0.995 phenotype 06/26/2019
63 566746 UTSW Stt3b 0.738 R7297 G1 225.01 N 9 115276957 I150T A G missense Het probably damaging 0.999 phenotype 06/26/2019
64 566748 UTSW Susd2 0.127 R7297 G1 225.01 N 10 75642568 D58G T C missense Het probably benign 0.188 06/26/2019
65 566722 UTSW Tex46 0.065 R7297 G1 225.01 N 4 136612901 V99G T G missense Het probably damaging 0.972 06/26/2019
66 566764 UTSW Tgfbi 0.171 R7297 G1 225.01 N 13 56632113 F492I T A missense Het possibly damaging 0.741 phenotype 06/26/2019
67 566728 UTSW Tmem132c 0.115 R7297 G1 225.01 N 5 127360217 A257T G A missense Het probably benign 0.064 06/26/2019
68 566718 UTSW Trim2 0.237 R7297 G1 225.01 N 3 84210233 I51K A T missense Het probably damaging 1.000 phenotype 06/26/2019
69 566709 UTSW Tsn 0.383 R7297 G1 225.01 N 1 118300861 Y210* A T nonsense Het probably null phenotype 06/26/2019
70 566776 UTSW Umodl1 0.000 R7297 G1 225.01 N 17 31008665 R1324H G A missense Het probably benign 0.056 06/26/2019
71 566727 UTSW Utp3 R7297 G1 208.01 N 5 88554517 G C start gained Het probably benign 06/26/2019
72 566731 UTSW Vmn1r5 0.054 R7297 G1 225.01 N 6 56986219 N293I A T missense Het possibly damaging 0.937 06/26/2019
73 566774 UTSW Vmn2r124 0.081 R7297 G1 225.01 N 17 18073573 I641F A T missense Het probably damaging 1.000 06/26/2019
74 566750 UTSW Vmn2r84 0.068 R7297 G1 225.01 N 10 130391250 N240D T C missense Het probably benign 0.190 06/26/2019
75 566780 UTSW Wbp1l 0.000 R7297 G1 225.01 N 19 46654400 D264G A G missense Het possibly damaging 0.921 06/26/2019
[records 1 to 75 of 75]