Incidental Mutations

81 incidental mutations are currently displayed, and affect 81 genes.
15 are Possibly Damaging.
24 are Probably Damaging.
26 are Probably Benign.
11 are Probably Null.
5 create premature stop codons.
4 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 81 of 81] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 567252 UTSW 4932415D10Rik 0.095 R7305 G1 225.01 N 10 82285119 I4019K A T missense Het probably benign 0.065 06/26/2019
2 567284 UTSW 9130011E15Rik 1.000 R7305 G1 225.01 N 19 45892121 M508K A T missense Het probably benign 0.355 06/26/2019
3 567215 UTSW Abhd16b 0.108 R7305 G1 224.01 N 2 181493416 D37V A T missense Het possibly damaging 0.848 06/26/2019
4 567280 UTSW Ankhd1 0.000 R7305 G1 225.01 N 18 36632205 D87G A G missense Het 06/26/2019
5 567266 UTSW Ankrd31 0.299 R7305 G1 225.01 N 13 96878971 S1583G A G missense Het probably damaging 0.989 06/26/2019
6 567216 UTSW Ankub1 0.000 R7305 G1 99.01 N 3 57692517 T C start gained Het probably benign 06/26/2019
7 567251 UTSW Apba3 0.477 R7305 G1 225.01 N 10 81271233 D264G A G missense Het probably damaging 1.000 phenotype 06/26/2019
8 567273 UTSW Asap1 0.167 R7305 G1 225.01 N 15 64130250 T404M G A missense Het probably damaging 1.000 phenotype 06/26/2019
9 567233 UTSW Cnot3 1.000 R7305 G1 225.01 N 7 3645480 A T start gained Het probably benign phenotype 06/26/2019
10 567281 UTSW Cxxc1 1.000 R7305 G1 225.01 N 18 74219396 Y349C A G missense Het probably benign 0.020 phenotype 06/26/2019
11 567236 UTSW Cyfip1 1.000 R7305 G1 217.47 N 7 55928189 AGTGT AGT frame shift Het probably null phenotype 06/26/2019
12 567226 UTSW Cyp3a57 0.072 R7305 G1 225.01 N 5 145370985 I184V A G missense Het probably benign 0.032 06/26/2019
13 567257 UTSW D130052B06Rik 0.074 R7305 G1 130.47 N 11 33623355 GTCTACACTGTCCTGCACAGGTGACCCATCTACCCCGTCCTATCCTGGCGACCCATCTACACTGTCCTG GTCTACACTGTCCTG frame shift Het probably null 06/26/2019
14 567220 UTSW Dab1 0.806 R7305 G1 225.01 N 4 104713790 D210E T A missense Het phenotype 06/26/2019
15 567241 UTSW Elavl1 1.000 R7305 G1 218.01 N 8 4325199 G A unclassified Het probably benign phenotype 06/26/2019
16 567222 UTSW Emilin1 0.145 R7305 G1 225.01 N 5 30917089 Q225* C T nonsense Het probably null phenotype 06/26/2019
17 567256 UTSW Eml6 0.231 R7305 G1 225.01 N 11 29777258 A1288E G T missense Het probably benign 0.011 06/26/2019
18 567221 UTSW Eno1 1.000 R7305 G1 225.01 N 4 150245339 T C critical splice donor site 2 bp Het probably null phenotype 06/26/2019
19 567208 UTSW Eprs 1.000 R7305 G1 225.01 N 1 185379701 R303C C T missense Het probably damaging 0.995 phenotype 06/26/2019
20 567242 UTSW Eps15l1 0.214 R7305 G1 225.01 N 8 72373034 A651V G A missense Het probably benign 0.000 06/26/2019
21 567209 UTSW Etl4 0.842 R7305 G1 225.01 N 2 20709557 I156F A T missense Het probably damaging 1.000 phenotype 06/26/2019
22 567274 UTSW Faim2 0.225 R7305 G1 225.01 N 15 99513933 I171N A T missense Het probably damaging 0.992 phenotype 06/26/2019
23 567271 UTSW Fam105a 0.063 R7305 G1 225.01 N 15 27658233 C184R A G missense Het probably benign 0.073 06/26/2019
24 567205 UTSW Fam135a 0.626 R7305 G1 225.01 N 1 24030858 N381I T A missense Het probably damaging 0.997 06/26/2019
25 567217 UTSW Fam160a1 1.000 R7305 G1 225.01 N 3 85730524 P156Q G T missense Het probably damaging 0.999 06/26/2019
26 567262 UTSW Fam71d 0.063 R7305 G1 225.01 N 12 78715035 K158E A G missense Het possibly damaging 0.850 06/26/2019
27 567237 UTSW Gabrg3 0.000 R7305 G1 225.01 N 7 56735085 M243L T A missense Het probably benign 0.006 phenotype 06/26/2019
28 567249 UTSW Gm5134 0.106 R7305 G1 225.01 N 10 76000399 I405V A G missense Het probably damaging 0.997 06/26/2019
29 567232 UTSW Gm6614 0.059 R7305 G1 225.01 N 6 141992494 A253V G A missense Het probably damaging 0.999 06/26/2019
30 567270 UTSW Gm9376 0.160 R7305 G1 225.01 N 14 118267356 K67* A T nonsense Het probably null 06/26/2019
31 567227 UTSW Grm8 0.000 R7305 G1 225.01 N 6 27761355 I290K A T missense Het possibly damaging 0.506 phenotype 06/26/2019
32 567214 UTSW Hao1 0.074 R7305 G1 225.01 N 2 134548201 M73L T A missense Het probably benign 0.005 phenotype 06/26/2019
33 567245 UTSW Herc1 0.000 R7305 G1 225.01 N 9 66461868 D452G A G missense Het phenotype 06/26/2019
34 567213 UTSW Idh3b 0.000 R7305 G1 225.01 N 2 130281493 K192N C A missense Het possibly damaging 0.886 phenotype 06/26/2019
35 567229 UTSW Igkv6-23 0.215 R7305 G1 225.01 N 6 70260569 S63P A G missense Het probably benign 0.289 06/26/2019
36 567250 UTSW Itgb2 0.355 R7305 G1 225.01 N 10 77548564 D173A A C missense Het probably damaging 1.000 phenotype 06/26/2019
37 567278 UTSW Jmjd8 0.000 R7305 G1 225.01 N 17 25830327 T255S A T missense Het probably benign 0.129 phenotype 06/26/2019
38 567210 UTSW Lamc3 0.000 R7305 G1 173.01 N 2 31930702 E1243A A C missense Het probably benign 0.387 phenotype 06/26/2019
39 567212 UTSW Map1a 0.356 R7305 G1 225.01 N 2 121299458 T252A A G missense Het probably damaging 0.999 phenotype 06/26/2019
40 567235 UTSW Mrgpra1 0.055 R7305 G1 225.01 N 7 47335455 A159S C A missense Het probably benign 0.383 06/26/2019
41 567219 UTSW Ndst3 0.158 R7305 G1 225.01 N 3 123601482 I500V T C missense Het possibly damaging 0.622 phenotype 06/26/2019
42 567248 UTSW Nhsl1 0.000 R7305 G1 225.01 N 10 18531686 T1523A A G missense Het possibly damaging 0.942 06/26/2019
43 567265 UTSW Nr2f1 1.000 R7305 G1 225.01 N 13 78195179 I322T A G missense Het probably damaging 0.999 phenotype 06/26/2019
44 567230 UTSW Nup210 0.000 R7305 G1 225.01 N 6 91087966 E184G T C missense Het probably damaging 0.998 phenotype 06/26/2019
45 567206 UTSW Obsl1 0.207 R7305 G1 225.01 N 1 75493946 W1022* C T nonsense Het probably null 06/26/2019
46 567211 UTSW Olfr1250 0.072 R7305 G1 225.01 N 2 89656502 H313L T A missense Het probably benign 0.000 phenotype 06/26/2019
47 567276 UTSW Olfr166 0.078 R7305 G1 225.01 N 16 19487699 I287N T A missense Het probably damaging 0.982 phenotype 06/26/2019
48 567240 UTSW Olfr470 0.346 R7305 G1 225.01 N 7 107845365 Y123N A T missense Het probably damaging 0.998 phenotype 06/26/2019
49 567239 UTSW Olfr551 0.084 R7305 G1 225.01 N 7 102587955 Q263K G T missense Het possibly damaging 0.936 phenotype 06/26/2019
50 567254 UTSW Olfr802 0.000 R7305 G1 225.01 N 10 129682280 I153N A T missense Het probably damaging 0.992 phenotype 06/26/2019
51 567255 UTSW Olfr808 0.056 R7305 G1 225.01 N 10 129767851 Y118* T A nonsense Het probably null phenotype 06/26/2019
52 567272 UTSW Oxr1 0.000 R7305 G1 225.01 N 15 41813608 P187L C T missense Het not run phenotype 06/26/2019
53 567268 UTSW Parp8 0.000 R7305 G1 225.01 N 13 116894925 L417P A G missense Het possibly damaging 0.954 06/26/2019
54 567261 UTSW Pdia6 1.000 R7305 G1 225.01 N 12 17274508 Q120R A G missense Het probably benign 0.202 phenotype 06/26/2019
55 567269 UTSW Ppp3cc 0.000 R7305 G1 225.01 N 14 70240803 N290S T C missense Het probably benign 0.000 phenotype 06/26/2019
56 567228 UTSW Prdm5 0.000 R7305 G1 225.01 N 6 65831260 S63R C A missense Het possibly damaging 0.827 phenotype 06/26/2019
57 567223 UTSW Prr14l 0.138 R7305 G1 225.01 N 5 32831101 D350G T C missense Het probably benign 0.145 06/26/2019
58 567258 UTSW Pwwp2a 0.136 R7305 G1 225.01 N 11 43717051 L497S T C missense Het probably damaging 0.977 06/26/2019
59 567253 UTSW R3hdm2 0.621 R7305 G1 225.01 N 10 127476678 N430D A G missense Het probably benign 0.079 06/26/2019
60 567260 UTSW Rad51ap2 0.000 R7305 G1 225.01 N 12 11457343 N422S A G missense Het possibly damaging 0.679 06/26/2019
61 567279 UTSW Rbbp8 1.000 R7305 G1 225.01 N 18 11672581 G A critical splice acceptor site Het probably null phenotype 06/26/2019
62 567238 UTSW Rsf1 1.000 R7305 G1 217.47 N 7 97579918 GGCGGCGGC GGCGGCGGCAGCGGCGGC unclassified Het probably benign phenotype 06/26/2019
63 567282 UTSW Slc22a6 0.059 R7305 G1 225.01 N 19 8622158 G A critical splice donor site 1 bp Het probably null phenotype 06/26/2019
64 567264 UTSW Slc28a3 0.000 R7305 G1 201.01 N 13 58566231 E440V T A missense Het possibly damaging 0.655 phenotype 06/26/2019
65 567267 UTSW Slc30a5 0.459 R7305 G1 225.01 N 13 100811424 I482K A T missense Het probably damaging 0.980 phenotype 06/26/2019
66 567231 UTSW Slco1a1 0.245 R7305 G1 225.01 N 6 141924497 F305Y A T missense Het probably damaging 0.999 phenotype 06/26/2019
67 567207 UTSW Slco4c1 0.206 R7305 G1 225.01 N 1 96828965 N544S T C missense Het probably damaging 0.999 phenotype 06/26/2019
68 567275 UTSW Smpd4 0.161 R7305 G1 225.01 N 16 17641783 I656N T A missense Het probably damaging 0.991 phenotype 06/26/2019
69 567259 UTSW Taok1 0.660 R7305 G1 225.01 N 11 77541674 L771* A T nonsense Het probably null 06/26/2019
70 567243 UTSW Tmem231 1.000 R7305 G1 225.01 N 8 111915295 D209G T C missense Het possibly damaging 0.696 phenotype 06/26/2019
71 567244 UTSW Tmem25 0.067 R7305 G1 225.01 N 9 44795408 A G critical splice donor site 2 bp Het probably null 06/26/2019
72 567218 UTSW Tmem79 0.000 R7305 G1 225.01 N 3 88333411 T77A T C missense Het probably benign 0.003 phenotype 06/26/2019
73 567246 UTSW Topbp1 1.000 R7305 G1 225.01 N 9 103328637 T825S A T missense Het probably damaging 1.000 phenotype 06/26/2019
74 567283 UTSW Trpm6 1.000 R7305 G1 225.01 N 19 18876091 Q1825L A T missense Het probably benign 0.296 phenotype 06/26/2019
75 567285 UTSW Uba1y 0.029 R7305 G1 222 N Y 821348 D110E T A missense Het probably damaging 1.000 06/26/2019
76 567247 UTSW Utrn 0.000 R7305 G1 225.01 N 10 12385536 N3422K A T missense Het probably benign 0.000 phenotype 06/26/2019
77 567263 UTSW Vmn1r219 0.056 R7305 G1 225.01 N 13 23163144 M168L A T missense Het probably benign 0.000 06/26/2019
78 567234 UTSW Vmn2r62 0.152 R7305 G1 225.01 N 7 42764811 H736R T C missense Het possibly damaging 0.758 06/26/2019
79 567224 UTSW Wdr1 1.000 R7305 G1 225.01 N 5 38540092 H291R T C missense Het possibly damaging 0.897 phenotype 06/26/2019
80 567225 UTSW Zan 0.097 R7305 G1 225.01 N 5 137415139 T3177A T C missense Het unknown phenotype 06/26/2019
81 567277 UTSW Zbtb21 0.462 R7305 G1 225.01 N 16 97951295 H596R T C missense Het possibly damaging 0.915 06/26/2019
[records 1 to 81 of 81]