Incidental Mutations

36 incidental mutations are currently displayed, and affect 36 genes.
9 are Possibly Damaging.
13 are Probably Damaging.
10 are Probably Benign.
4 are Probably Null.
3 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 36 of 36] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 152598 UTSW 9530002B09Rik 0.018 V7582 225 N stinger 4 122701257 H102L A T missense Het possibly damaging 0.711 0.049 01/29/2014
2 152590 UTSW Ahcy 1.000 V7582 225 N stinger 2 155064921 R151* G A nonsense Het probably null 0.622 ax allele for a deletion that includes the Ahcy gene. [provided by MGI curators] (source: MGI)">phenotype 01/29/2014
3 152583 UTSW Atp6v1h 0.912 V7582 225 N stinger 1 5124443 T282A A G missense Het possibly damaging 0.937 0.210 phenotype 01/29/2014
4 152619 UTSW Cdc42bpb 0.560 V7582 225 N stinger 12 111296391 G1501S C T missense Het probably benign 0.275 0.112 phenotype 01/29/2014
5 152621 UTSW Dnajc22 0.101 V7582 155 N stinger 15 99101482 Y183N T A missense Het probably damaging 0.993 0.158 01/29/2014
6 152593 UTSW Dpyd 0.269 V7582 225 N stinger 3 118897126 Q295* C T nonsense Het probably null 0.606 phenotype 01/29/2014
7 152588 UTSW Erv3 0.091 V7582 225 N stinger 2 131855926 H171R T C missense Het possibly damaging 0.663 0.052 01/29/2014
8 152596 UTSW Fam221b 0.092 V7582 225 N stinger 4 43665865 T249A T C missense Het probably benign 0.000 0.157 01/29/2014
9 152602 UTSW Fbrsl1 0.230 V7582 225 N stinger 5 110379426 A129T C T missense Het possibly damaging 0.904 0.069 01/29/2014
10 152592 UTSW Fcgr1 0.168 V7582 225 N stinger 3 96284276 *405W T C makesense Het probably null 0.612 phenotype 01/29/2014
11 152617 UTSW Gm4787 0.046 V7582 225 N stinger 12 81377567 Q606* G A nonsense Het probably null 0.678 01/29/2014
12 152622 UTSW Hira 1.000 V7582 225 N stinger 16 18894821 A29T G A missense Het probably damaging 1.000 0.302 phenotype 01/29/2014
13 152609 UTSW Izumo4 0.000 V7582 225 N stinger 10 80703891 T155S A T missense Het probably benign 0.024 0.042 01/29/2014
14 152584 UTSW Kcnb2 0.000 V7582 225 N stinger 1 15710091 I396V A G missense Het probably benign 0.070 0.038 phenotype 01/29/2014
15 152604 UTSW Lpar5 0.136 V7582 142 N stinger 6 125081727 A137E C A missense Het possibly damaging 0.883 0.048 phenotype 01/29/2014
16 152586 UTSW Lrp4 0.620 V7582 225 N stinger 2 91488518 S900L C T missense Het possibly damaging 0.956 0.057 phenotype 01/29/2014
17 152624 UTSW Med20 0.953 V7582 209 N stinger 17 47618832 V65M G A missense Het probably damaging 0.997 0.574 phenotype 01/29/2014
18 152610 UTSW Myrfl 0.314 V7582 211 N stinger 10 116861530 T30A T C missense Het probably damaging 0.997 0.062 01/29/2014
19 152585 UTSW Olfr1406 0.172 V7582 225 N stinger 1 173183964 L157I G T missense Het probably benign 0.045 0.125 phenotype 01/29/2014
20 152613 UTSW Otop3 0.077 V7582 141 N stinger 11 115344838 L432Q T A missense Het probably damaging 1.000 0.380 01/29/2014
21 152618 UTSW Papln 0.129 V7582 163 N stinger 12 83778834 R608C C T missense Het possibly damaging 0.722 0.058 01/29/2014
22 152611 UTSW Pelp1 0.912 V7582 225 N stinger 11 70398150 T257S T A missense Het probably damaging 0.986 0.222 phenotype 01/29/2014
23 152600 UTSW Pik3cd 0.882 V7582 168 N stinger 4 149657319 L390R A C missense Het probably damaging 1.000 0.404 phenotype 01/29/2014
24 152607 UTSW Plekhb1 0.000 V7582 152 N stinger 7 100654618 T112A T C missense Het probably benign 0.355 0.024 phenotype 01/29/2014
25 152591 UTSW Rbbp8nl 0.027 V7582 225 N stinger 2 180278208 T558S T A missense Het probably benign 0.028 0.124 01/29/2014
26 152601 UTSW Rundc3b 0.181 V7582 117 N stinger 5 8622549 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC small deletion Het probably benign 01/29/2014
27 152587 UTSW Slc30a4 0.286 V7582 225 N stinger 2 122689538 M136L T A missense Het probably benign 0.001 0.136 phenotype 01/29/2014
28 152594 UTSW Spaca1 0.000 V7582 225 N stinger 4 34039311 E192G T C missense Het probably damaging 0.989 0.218 phenotype 01/29/2014
29 152589 UTSW Thbd 1.000 V7582 179 N stinger 2 148407190 Y253N A T missense Het probably benign 0.051 0.112 phenotype 01/29/2014
30 152623 UTSW Tiam1 0.000 V7582 139 N stinger 16 89865271 R653H C T missense Het probably damaging 1.000 0.270 phenotype 01/29/2014
31 152614 UTSW Tnrc6c 0.000 V7582 225 N stinger 11 117723326 R770H G A missense Het probably damaging 1.000 0.474 phenotype 01/29/2014
32 152597 UTSW Toe1 0.617 V7582 225 N stinger 4 116806111 N56K A T missense Het probably damaging 1.000 0.394 01/29/2014
33 152603 UTSW Tprkb 0.148 V7582 225 N stinger 6 85928782 K150E A G missense Het probably damaging 0.957 0.240 01/29/2014
34 152620 UTSW Wdr60 0.667 V7582 216 N stinger 12 116211840 S906A A C missense Het possibly damaging 0.730 0.016 phenotype 01/29/2014
35 152595 UTSW Zfp292 0.648 V7582 225 N stinger 4 34806783 C2087Y C T missense Het possibly damaging 0.853 0.058 01/29/2014
36 152599 UTSW Zfp933 0.111 V7582 225 N stinger 4 147826470 A223V G A missense Het probably damaging 0.980 0.226 01/29/2014
[records 1 to 36 of 36]