Incidental Mutations

1 incidental mutations are currently displayed, and affect 1 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
1 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 1 of 1] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 262118 UTSW Cherp 0.956 T0722 G3 217 N 711 8 72462034 TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA small deletion Het probably benign 02/04/2015
[records 1 to 1 of 1]