Incidental Mutations

394,160 incidental mutations are currently displayed, and affect 23,678 genes.
58,462 are Possibly Damaging.
127,106 are Probably Damaging.
134,809 are Probably Benign.
36,801 are Probably Null.
17,210 create premature stop codons.
6,640 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
|< first << previous [records 386601 to 386700 of 394160] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
386601 403356 UTSW Zfp280d R5214 G1 225 Y 9 72308113 W323R T A missense Het noncoding transcript 07/22/2016
386602 431409 UTSW Zfp280d R5518 G1 225 N 9 72324135 H451R A G missense Het probably damaging 0.994 10/05/2016
386603 436292 UTSW Zfp280d R5546 G1 225 N 9 72308099 C318Y G A missense Het noncoding transcript 10/24/2016
386604 454771 UTSW Zfp280d R5853 G1 225 N 9 72330942 T528I C T missense Het probably benign 0.196 02/10/2017
386605 460555 UTSW Zfp280d R5945 G1 225 N 9 72362332 L917* T A nonsense Het probably null 02/28/2017
386606 480515 UTSW Zfp280d R6033 G1 225.01 N 9 72329137 L519Q T A missense Het probably damaging 1.000 06/26/2017
386607 7366 APN Zfp281 IGL00531 G1 1 136627910 D875E T A missense Het probably damaging 1.000 phenotype 04/20/2012
386608 79864 APN Zfp281 IGL01408 G1 1 136626115 V277A T C missense Het probably damaging 1.000 phenotype 11/05/2013
386609 184562 APN Zfp281 IGL02037 G1 1 136627447 V721A T C missense Het possibly damaging 0.880 phenotype 05/07/2014
386610 413966 APN Zfp281 IGL03233 1 136626829 Q⇒R A G missense Het possibly damaging 0.950 phenotype 08/02/2016
386611 168596 UTSW Zfp281 R1514 G1 225 Y 1 136626697 N471S A G missense Het probably benign 0.002 phenotype 04/13/2014
386612 195968 UTSW Zfp281 R1784 G1 159 N 1 136625353 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC small insertion Het unknown phenotype 05/23/2014
386613 196312 UTSW Zfp281 R1785 G1 113 N 1 136625353 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC small insertion Het unknown phenotype 05/23/2014
386614 226190 UTSW Zfp281 R2049 G1 129 Y 1 136625353 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC small insertion Het unknown phenotype 09/17/2014
386615 236325 UTSW Zfp281 R2142 G1 207 N 1 136625353 GCGGCAGCTCCGGCAGC GCGGCAGCTCCGGCAGCTCCGGCAGC small insertion Het unknown phenotype 10/01/2014
386616 317347 UTSW Zfp281 R4086 G1 225 Y 1 136626121 I279N T A missense Het probably damaging 1.000 phenotype 05/15/2015
386617 317400 UTSW Zfp281 R4087 G1 225 Y 1 136626121 I279N T A missense Het probably damaging 1.000 phenotype 05/15/2015
386618 317448 UTSW Zfp281 R4088 G1 225 Y 1 136626121 I279N T A missense Het probably damaging 1.000 phenotype 05/15/2015
386619 317542 UTSW Zfp281 R4090 G1 225 Y 1 136626121 I279N T A missense Het probably damaging 1.000 phenotype 05/15/2015
386620 370029 UTSW Zfp281 R4819 G1 96 N 1 136625710 H142R A G missense Het probably benign 0.001 phenotype 02/04/2016
386621 425786 UTSW Zfp281 R5380 G1 225 N 1 136625938 K218R A G missense Het probably damaging 0.959 phenotype 08/04/2016
386622 480492 UTSW Zfp281 R6033 G1 225.01 N 1 136626726 S481P T C missense Het probably benign 0.220 phenotype 06/26/2017
386623 484351 UTSW Zfp281 R6056 G1 225.01 N 1 136625440 F52S T C missense Het probably damaging 0.958 phenotype 07/14/2017
386624 277866 APN Zfp282 IGL00732 G1 6 47880390 P186S C T missense Het probably damaging 1.000 04/16/2015
386625 14959 APN Zfp282 IGL00755 G1 6 47880390 P186S C T missense Het probably damaging 1.000 12/06/2012
386626 278358 APN Zfp282 IGL01402 G1 6 47897836 D⇒A A C missense Het probably damaging 1.000 04/16/2015
386627 278396 APN Zfp282 IGL01404 G1 6 47897836 D⇒A A C missense Het probably damaging 1.000 04/16/2015
386628 88853 APN Zfp282 IGL01484 G1 6 47890120 N214D A G missense Het probably damaging 0.980 11/18/2013
386629 90823 APN Zfp282 IGL01560 G1 6 47880277 E148V A T missense Het probably damaging 1.000 12/09/2013
386630 364889 APN Zfp282 IGL02949 6 47897914 T⇒I C T missense Het probably damaging 1.000 12/18/2015
386631 64736 UTSW Zfp282 R0020 G1 103 Y 6 47880009 W59G T G missense Het probably damaging 0.995 08/06/2013
386632 20920 UTSW Zfp282 R0118 G1 225 N 6 47892932 R304G A G missense Het possibly damaging 0.862 04/11/2013
386633 40229 UTSW Zfp282 R0415 G1 182 Y 6 47897881 D340G A G missense Het probably damaging 0.992 05/23/2013
386634 177897 UTSW Zfp282 R0415 G1 60 Y 6 47905053 I558N T A missense Het possibly damaging 0.876 04/30/2014
386635 54256 UTSW Zfp282 R0607 G1 225 N 6 47880369 N179D A G missense Het probably damaging 0.999 07/11/2013
386636 62695 UTSW Zfp282 R0710 G1 100 N 6 47880384 R184W C T missense Het probably damaging 1.000 07/30/2013
386637 82096 UTSW Zfp282 R0946 G1 225 N 6 47880009 W59R T A missense Het probably damaging 0.999 11/08/2013
386638 94178 UTSW Zfp282 R1054 G1 177 N 6 47904599 S407T T A missense Het probably benign 0.001 01/05/2014
386639 160119 UTSW Zfp282 R1401 G1 225 Y 6 47890174 K232* A T nonsense Het probably null 03/14/2014
386640 170835 UTSW Zfp282 R1572 G1 204 Y 6 47892867 L282Q T A missense Het probably damaging 0.998 04/13/2014
386641 266042 UTSW Zfp282 R2016 G1 225 N 6 47897787 T A intron Het probably null 02/05/2015
386642 265675 UTSW Zfp282 R2971 G1 213 Y 6 47897932 A T splice site 4 bp Het probably null 02/05/2015
386643 475612 UTSW Zfp282 R3417 G1 225 N 6 47890098 L212F C T missense Het noncoding transcript 05/11/2017
386644 316009 UTSW Zfp282 R4064 G1 225 Y 6 47880094 R87H G A missense Het probably damaging 0.992 05/15/2015
386645 331352 UTSW Zfp282 R4478 G1 225 Y 6 47890696 R269* A T nonsense Het probably null 07/21/2015
386646 333074 UTSW Zfp282 R4530 G1 225 Y 6 47890633 P248S C T missense Het probably benign 0.003 08/18/2015
386647 333144 UTSW Zfp282 R4532 G1 225 Y 6 47890633 P248S C T missense Het probably benign 0.003 08/18/2015
386648 388435 UTSW Zfp282 R5068 G1 204 N 6 47877703 Q11P A C missense Het probably benign 0.011 06/06/2016
386649 401432 UTSW Zfp282 R5261 G1 225 Y 6 47897890 D343G A G missense Het probably damaging 0.992 07/06/2016
386650 421951 UTSW Zfp282 R5326 G1 225 N 6 47905327 N649K T A missense Het probably benign 0.000 08/04/2016
386651 435119 UTSW Zfp282 R5551 G1 225 N 6 47890645 A252S G T missense Het possibly damaging 0.590 10/24/2016
386652 483282 UTSW Zfp282 R6046 G1 225.01 N 6 47880168 V112M G A missense Het probably damaging 1.000 07/14/2017
386653 385654 UTSW Zfp282 S24628 222 N waterfowl 6 47897881 D340G A G missense Homo probably damaging 0.992 05/10/2016
386654 385655 UTSW Zfp282 S24628 222 N waterfowl 6 47905053 I558N T A missense Homo possibly damaging 0.876 05/10/2016
386655 302481 APN Zfp286 IGL02659 11 62783737 N⇒S T C missense Het probably benign 04/16/2015
386656 306119 APN Zfp286 IGL02745 11 62780874 K⇒N C A missense Het probably damaging 0.980 04/16/2015
386657 361220 APN Zfp286 IGL02826 11 62787960 Q⇒R T C missense Het possibly damaging 0.920 12/18/2015
386658 65956 UTSW Zfp286 R0233 G1 184 N 11 62780393 T285A T C missense Het possibly damaging 0.578 08/19/2013
386659 25528 UTSW Zfp286 R0318 G1 225 N 11 62784962 D58G T C missense Het possibly damaging 0.820 04/16/2013
386660 217584 UTSW Zfp286 R1954 G1 225 Y 11 62783708 S104P A G missense Het probably benign 0.042 08/01/2014
386661 224183 UTSW Zfp286 R1994 G1 225 N 11 62779820 S476P A G missense Het probably damaging 0.999 08/25/2014
386662 237780 UTSW Zfp286 R2186 G1 225 Y 11 62780461 V262A A G missense Het probably damaging 0.968 10/02/2014
386663 321911 UTSW Zfp286 R4258 G1 225 Y 11 62781070 I121V T C missense Het probably benign 0.072 06/20/2015
386664 324427 UTSW Zfp286 R4327 G1 225 Y 11 62780018 C410R A G missense Het probably damaging 1.000 06/24/2015
386665 329056 UTSW Zfp286 R4453 G1 225 N 11 62780204 G348R C G missense Het probably damaging 1.000 07/21/2015
386666 331406 UTSW Zfp286 R4479 G1 225 Y 11 62780204 G348R C G missense Het probably damaging 1.000 07/21/2015
386667 350404 UTSW Zfp286 R4647 G1 225 N 11 62783733 Y95* A C nonsense Het probably null 10/08/2015
386668 352064 UTSW Zfp286 R4667 G1 225 N 11 62780602 V215A A G missense Het probably benign 0.001 10/08/2015
386669 367860 UTSW Zfp286 R4775 G1 208 N 11 62783809 Y115H A G missense Het noncoding transcript 12/29/2015
386670 375436 UTSW Zfp286 R4883 G1 225 N 11 62780629 D206G T C missense Het probably benign 0.010 03/17/2016
386671 384621 UTSW Zfp286 R4978 G1 225 Y 11 62788928 A G unclassified 2 bp Het probably null 05/10/2016
386672 392947 UTSW Zfp286 R5120 G1 225 Y 11 62780725 M174K A T missense Het probably benign 0.403 06/15/2016
386673 433766 UTSW Zfp286 R5533 G1 225 N 11 62780970 H154R T C missense Het unknown 10/06/2016
386674 462441 UTSW Zfp286 R5939 G1 225 N 11 62753462 R121S A C missense Het unknown 02/28/2017
386675 52249 APN Zfp287 IGL01084 G1 11 62713890 Y719* G T nonsense Het probably null 06/21/2013
386676 178614 APN Zfp287 IGL01868 G1 11 62715257 E264K C T missense Het probably benign 0.030 05/07/2014
386677 415856 APN Zfp287 IGL03290 11 62715236 F⇒L A G missense Het possibly damaging 0.800 08/02/2016
386678 34417 UTSW Zfp287 R0064 G1 225 Y 11 62714938 L370H A T missense Het possibly damaging 0.945 05/09/2013
386679 23233 UTSW Zfp287 R0193 G1 225 Y 11 62715029 S340T A T missense Het probably benign 0.121 04/16/2013
386680 66414 UTSW Zfp287 R0211 G1 141 N 11 62714917 H377R T C missense Het probably damaging 0.987 08/19/2013
386681 48861 UTSW Zfp287 R0525 G1 225 Y 11 62715244 V268E A T missense Het probably benign 0.000 06/12/2013
386682 218380 UTSW Zfp287 R0725 G1 80 Y 11 62714213 C612S A T missense Het probably damaging 0.996 08/01/2014
386683 188704 UTSW Zfp287 R1405 G1 225 N 11 62728311 D108V T A missense Het probably damaging 0.999 05/09/2014
386684 159599 UTSW Zfp287 R1416 G1 225 Y 11 62714340 H569Q A T missense Het probably damaging 0.999 03/14/2014
386685 163546 UTSW Zfp287 R1487 G1 225 N 11 62725289 K181R T C missense Het probably damaging 0.984 03/28/2014
386686 220155 UTSW Zfp287 R2023 G1 225 Y 11 62714982 Y355* A C nonsense Het probably null 08/25/2014
386687 221857 UTSW Zfp287 R2045 G1 225 Y 11 62727569 L146P A G missense Het probably damaging 0.960 08/25/2014
386688 250996 UTSW Zfp287 R2495 G1 225 Y 11 62714633 C483S A T missense Het probably damaging 0.991 12/04/2014
386689 272693 UTSW Zfp287 R3794 G1 225 Y 11 62714244 H612Q G T missense Het probably damaging 1.000 03/25/2015
386690 474507 UTSW Zfp287 R3902 G1 225 N 11 62712202 T241A T C missense Het probably benign 0.002 04/14/2017
386691 369824 UTSW Zfp287 R4816 G1 225 Y 11 62714248 T611K G T missense Het probably damaging 1.000 02/04/2016
386692 381023 UTSW Zfp287 R4928 G1 225 Y 11 62714136 C648* A T nonsense Het probably null 04/15/2016
386693 394477 UTSW Zfp287 R5048 G1 225 Y 11 62714951 K366E T C missense Het probably damaging 0.984 06/15/2016
386694 432482 UTSW Zfp287 R5498 G1 225 N 11 62728505 Q207R T C missense Het noncoding transcript 10/05/2016
386695 455015 UTSW Zfp287 R5858 G1 225 N 11 62714007 Q691H T A missense Het probably damaging 0.999 02/10/2017
386696 177974 UTSW Zfp292 F5770 G1 225 Y 4 34806783 C2092Y C T missense Het possibly damaging 0.770 05/07/2014
386697 6693 APN Zfp292 IGL00401 G1 4 34808683 C1459R A G missense Het probably benign 0.050 04/20/2012
386698 6691 APN Zfp292 IGL00502 G1 4 34809775 T1095A T C missense Het probably benign 0.290 04/20/2012
386699 6692 APN Zfp292 IGL00539 G1 4 34808790 P1423L G A missense Het possibly damaging 0.750 04/20/2012
386700 14961 APN Zfp292 IGL00676 G1 4 34807827 I1744S A C missense Het probably damaging 0.990 12/06/2012
|< first << previous [records 386601 to 386700 of 394160] next >> last >|