Incidental Mutations

396,423 incidental mutations are currently displayed, and affect 23,680 genes.
58,583 are Possibly Damaging.
127,404 are Probably Damaging.
135,030 are Probably Benign.
36,966 are Probably Null.
17,307 create premature stop codons.
6,806 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 396423] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 439487 UTSW Rapgef6 R4911 G1 200 Y 11 54622317 E269D A T Het possibly damaging 0.952 phenotype 11/02/2016
2 192678 UTSW 1110017D15Rik R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 05/23/2014
3 192500 UTSW 1700001C02Rik R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
4 243413 UTSW 1700001C19Rik R2256 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 10/16/2014
5 243483 UTSW 1700001C19Rik R2257 G1 204 Y 17 47433423 AC A critical splice acceptor site Het unknown 10/16/2014
6 273682 UTSW 1700001C19Rik R3498 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/02/2015
7 273727 UTSW 1700001C19Rik R3499 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/02/2015
8 275564 UTSW 1700001C19Rik R3834 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/06/2015
9 275608 UTSW 1700001C19Rik R3835 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/06/2015
10 308997 UTSW 1700001C19Rik R3901 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
11 309355 UTSW 1700001C19Rik R3910 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
12 309425 UTSW 1700001C19Rik R3911 G1 215 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
13 309536 UTSW 1700001C19Rik R3913 G1 217 Y 17 47433423 AC A critical splice acceptor site Het unknown 04/17/2015
14 30249 UTSW 1700011E24Rik R0364 G1 225 Y 17 87389714 T A critical splice acceptor site Het probably null 04/24/2013
15 478683 UTSW 1700019A02Rik R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
16 190952 UTSW 1700023F06Rik R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
17 207013 UTSW 1700026D08Rik R1828 G1 225 N 7 83791724 T G critical splice acceptor site Het probably null 06/23/2014
18 39342 UTSW 1700067P10Rik R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 05/23/2013
19 100613 UTSW 2010111I01Rik R1209 G1 225 N 13 63191064 A G critical splice acceptor site Het probably null phenotype 01/15/2014
20 89620 APN 2300002M23Rik IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null 12/03/2013
21 406142 UTSW 2310022A10Rik R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 07/28/2016
22 180063 APN 2700062C07Rik IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
23 208042 UTSW 4430402I18Rik R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 06/23/2014
24 382658 UTSW 4921507P07Rik R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
25 370200 UTSW 4930430A15Rik R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 02/04/2016
26 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
27 482208 UTSW 4930579C12Rik R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het unknown 07/11/2017
28 30068 UTSW 4932425I24Rik R0360 G1 225 Y 16 38298297 T A critical splice acceptor site Het probably null 04/24/2013
29 53494 APN 4932438A13Rik IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null 06/28/2013
30 212811 UTSW 4932438A13Rik R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null 07/14/2014
31 57694 UTSW 5430403G16Rik R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 07/11/2013
32 241496 UTSW 5430419D17Rik R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 10/15/2014
33 241616 UTSW 5430419D17Rik R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 10/15/2014
34 249756 UTSW 5830473C10Rik R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
35 185837 APN 8430419L09Rik IGL02071 G1 6 135227151 A G critical splice acceptor site Het probably null 05/07/2014
36 376254 UTSW 9930111J21Rik1 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
37 166432 UTSW A430105I19Rik R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
38 479514 UTSW A830018L16Rik R6007 G1 225.01 N 1 11511916 A G critical splice acceptor site Het probably null 06/26/2017
39 102103 UTSW Aak1 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null 01/15/2014
40 479868 UTSW Aanat R6013 G1 225.01 N 11 116596124 A T critical splice acceptor site Het probably null phenotype 06/26/2017
41 204589 UTSW Aass R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null 06/23/2014
42 12430 APN Abca12 IGL00813 G1 1 71353762 C A critical splice acceptor site Het probably null phenotype 12/06/2012
43 4474 APN Abca5 IGL00487 G1 11 110309450 T A critical splice acceptor site Het probably null 0.000 phenotype 04/20/2012
44 217018 UTSW Abca8a R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
45 486155 UTSW Abca8a R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het unknown 08/16/2017
46 204725 UTSW Abca8b R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 06/23/2014
47 49312 UTSW Abcb1b R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null phenotype 06/12/2013
48 261898 UTSW Abcb9 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 02/04/2015
49 275295 UTSW Abcc3 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null phenotype 04/02/2015
50 22524 UTSW Abcd4 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 04/16/2013
51 214910 UTSW Abcg8 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null phenotype 07/14/2014
52 58394 UTSW Abhd12 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null phenotype 07/11/2013
53 76737 UTSW Abi3bp R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 10/16/2013
54 440160 UTSW Abtb2 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably null 11/08/2016
55 172264 UTSW AC092752.1 R1547 G1 225 N 7 14477122 T A critical splice acceptor site Het probably null 04/13/2014
56 266910 UTSW Acaa1a R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 02/18/2015
57 48328 UTSW Acaca R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
58 183777 APN Acad9 IGL02016 G1 3 36088486 A T critical splice acceptor site Het probably null 05/07/2014
59 389143 UTSW Acadsb R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 06/06/2016
60 484254 UTSW Acap1 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably null 07/14/2017
61 209805 UTSW Aco1 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null phenotype 06/30/2014
62 93744 UTSW Actb Z0001 105 N 5 142905694 T TG critical splice acceptor site 2 bp Homo probably null phenotype 01/05/2014
63 157015 UTSW Actn1 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 02/11/2014
64 43485 UTSW Adam32 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 05/24/2013
65 36286 UTSW Adamts6 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null phenotype 05/09/2013
66 42073 UTSW Adcy4 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably null phenotype 05/23/2013
67 1004 APN Adgrv1 IGL00090 G1 13 81405408 T G critical splice acceptor site Het probably null phenotype 07/12/2011
68 168020 UTSW Adgrv1 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably null phenotype 04/13/2014
69 200922 UTSW Adh1 R1464 G1 225 N 3 138288747 A G critical splice acceptor site Het probably null phenotype 05/23/2014
70 383896 UTSW Agfg2 R4965 G1 225 N 5 137667177 C A critical splice acceptor site Het probably null 04/27/2016
71 231044 UTSW Ago1 R2117 G1 225 N 4 126463857 T A critical splice acceptor site Het probably null phenotype 09/18/2014
72 169062 UTSW Agr3 R1498 G1 225 Y 12 35934380 A T critical splice acceptor site Het probably null 04/13/2014
73 225965 UTSW Agtpbp1 R2001 G1 217 N 13 59475803 TGAAGATGCATCTTGAGAAGA TGAAGA critical splice acceptor site Het probably null phenotype 08/25/2014
74 401408 UTSW Aif1 R5260 G1 225 Y 17 35171941 T A critical splice acceptor site Het probably null phenotype 07/06/2016
75 241049 UTSW Akap8l R2214 G1 225 N 17 32338825 T C critical splice acceptor site Het probably null 10/15/2014
76 44067 UTSW Akap8l V5088 163 N 521 17 32336739 C G critical splice acceptor site Het probably null 05/31/2013
77 82856 UTSW Akr1a1 R0972 G1 225 Y 4 116640007 T C critical splice acceptor site Het probably null phenotype 11/08/2013
78 226869 UTSW Akr1c19 R2068 G1 225 N 13 4238392 A T critical splice acceptor site Het probably null 09/17/2014
79 231826 UTSW Alb R2092 G1 217 N 5 90463983 G GA critical splice acceptor site 1 bp Het probably null phenotype 09/18/2014
80 159344 UTSW Alcam R1433 G1 225 N 16 52295752 T C critical splice acceptor site Het probably null phenotype 03/14/2014
81 35119 UTSW Aldh1a7 R0268 G1 225 Y 19 20709502 T A critical splice acceptor site Het probably null 05/09/2013
82 158100 UTSW Aldh7a1 R1295 G1 225 Y 18 56546950 T C critical splice acceptor site Het probably null phenotype 02/18/2014
83 382641 UTSW Alg6 R4976 G1 225 N 4 99750728 G A critical splice acceptor site Het probably null 04/27/2016
84 66098 UTSW Alg8 R0238 G1 147 N 7 97383684 A T critical splice acceptor site Het probably null 08/19/2013
85 59225 UTSW Alg8 R0239 G1 225 Y 7 97383684 A T critical splice acceptor site Het probably null 07/11/2013
86 98646 UTSW Alg8 R1109 G1 225 Y 7 97383684 A T critical splice acceptor site Het probably null 01/05/2014
87 240040 UTSW Alkbh6 R2231 G1 225 N 7 30312590 G A critical splice acceptor site Het probably null 10/15/2014
88 50055 UTSW Alox5 R0543 G1 225 Y 6 116454317 T A critical splice acceptor site Het probably null phenotype 06/12/2013
89 102207 UTSW Alpk2 R1186 G1 225 Y 18 65294341 T C critical splice acceptor site Het probably null 01/15/2014
90 217167 UTSW Als2 R1950 G1 225 N 1 59185601 T A critical splice acceptor site Het probably null phenotype 08/01/2014
91 255433 UTSW Als2cl R2919 G1 225 Y 9 110897499 A T critical splice acceptor site Het probably null 12/29/2014
92 92553 APN Ambra1 IGL01620 G1 2 91911412 A G critical splice acceptor site Het probably null phenotype 12/09/2013
93 92881 APN Amfr IGL01629 G1 8 93987508 T A critical splice acceptor site Het probably null phenotype 12/09/2013
94 401442 UTSW Amfr R5261 G1 225 Y 8 93976170 T A critical splice acceptor site Het probably null phenotype 07/06/2016
95 29899 UTSW Amn R0357 G1 205 Y 12 111274141 A T critical splice acceptor site Het probably null phenotype 04/24/2013
96 201152 UTSW Ampd2 R1466 G1 141 N 3 108080337 T C critical splice acceptor site Het probably null phenotype 05/23/2014
97 177316 UTSW Ampd2 R1584 G1 179 Y 3 108080337 T C critical splice acceptor site Het probably null phenotype 04/24/2014
98 99680 UTSW Amz1 R1173 G1 173 Y 5 140751936 A T critical splice acceptor site Het probably null 01/15/2014
99 236289 UTSW Ankrd32 R2141 G1 225 Y 13 77049219 T A critical splice acceptor site Het probably null phenotype 10/01/2014
100 241231 UTSW Ankrd32 R2217 G1 225 N 13 77046706 T A critical splice acceptor site Het probably null phenotype 10/15/2014
[records 1 to 100 of 396423] next >> last >|