Incidental Mutations

415,620 incidental mutations are currently displayed, and affect 22,188 genes.
65,080 are Possibly Damaging.
153,172 are Probably Damaging.
144,011 are Probably Benign.
43,907 are Probably Null.
16,999 create premature stop codons.
11,715 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 415620] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 306639 APN 0610009L18Rik IGL00978 G1 11 120350947 T C Het 04/16/2015
2 415172 APN 1500002C15Rik IGL03268 4 155734191 G T Het 08/02/2016
3 540719 UTSW 1700007K13Rik 0.163 R6819 G1 145.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC Het phenotype 11/16/2018
4 332403 APN 1700009J07Rik IGL00429 G1 10 77893839 G A Het 08/05/2015
5 279471 APN 1700010H22Rik IGL02092 5 98566768 T A Het 04/16/2015
6 31 UTSW 1700016P04Rik N/A Y 294 6 13415773 T A Homo 11/06/2009
7 178664 APN 1700026F02Rik IGL01869 G1 8 71043045 A G Het 05/07/2014
8 622 UTSW 1700102H20Rik B6584 G3 Y supermodel 17 3559578 C T Homo 04/12/2011
9 42 UTSW 1810020O05Rik 0.377 N/A Y 294 6 87690791 A T Homo 11/06/2009
10 419446 APN 1810030O07Rik IGL03116 X 12669653 T C Het 08/02/2016
11 302942 APN 1810043G02Rik 0.080 IGL02671 10 77980550 A T Het phenotype 04/16/2015
12 295908 APN 2010300C02Rik 0.098 IGL02498 1 37623845 T C Het 04/16/2015
13 410960 APN 3110002H16Rik 0.603 IGL03147 G1 18 12169229 T C Het phenotype 08/02/2016
14 411659 APN 3110079O15Rik 0.233 IGL03166 1 87475211 A C Het phenotype 08/02/2016
15 286861 APN 4921504E06Rik 0.030 IGL02264 2 19542369 A G Het 0.597 04/16/2015
16 413676 APN 4921511C20Rik IGL03222 X 127395470 A G Het 08/02/2016
17 416196 APN 4921511C20Rik IGL03299 X 127395853 A G Het 08/02/2016
18 361232 APN 4930404N11Rik 0.066 IGL02826 10 81364736 A G Het 12/18/2015
19 306636 APN 4930519F16Rik IGL00976 G1 X 103183262 A G Het 04/16/2015
20 291543 APN 4930555F03Rik 0.197 IGL02386 8 49500437 G A Het 04/16/2015
21 299436 APN 4930584F24Rik 0.247 IGL02583 5 26479719 C T Het 04/16/2015
22 281353 APN 4930595M18Rik 0.201 IGL02137 X 81457656 T C Het 04/16/2015
23 282995 APN 4933409G03Rik 0.176 IGL02173 2 68613057 A G Het 04/16/2015
24 286478 APN 4933409G03Rik 0.176 IGL02252 2 68614334 A G Het 04/16/2015
25 411862 APN A530053G22Rik 0.157 IGL03172 6 60402062 A T Het 08/02/2016
26 420196 APN A530053G22Rik 0.157 IGL03368 6 60403545 T C Het 08/02/2016
27 362822 APN Aatf 1.000 IGL02881 11 84471289 A G Het phenotype 12/18/2015
28 420198 APN Abca5 0.130 IGL03368 11 110313522 A G Het phenotype 08/02/2016
29 297770 APN Abcb5 0.272 IGL02544 12 118906268 A T Het phenotype 04/16/2015
30 543419 UTSW Abcc12 0.101 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
31 302256 APN Abcc8 0.541 IGL02653 7 46115767 T C Het phenotype 04/16/2015
32 281832 APN Acadsb 0.159 IGL02147 7 131425881 T A Het phenotype 04/16/2015
33 417977 APN Acadsb 0.159 IGL03083 7 131441193 A C Het phenotype 08/02/2016
34 296572 APN Accsl 0.067 IGL02511 2 93861766 A T Het 04/16/2015
35 414502 APN Accsl 0.067 IGL03248 2 93862784 A G Het 08/02/2016
36 288763 APN Ace 0.684 IGL02333 11 105971447 G A Het phenotype 04/16/2015
37 284341 APN Ace2 0.131 IGL02183 X 164177469 T A Het phenotype 04/16/2015
38 364981 APN Acp2 0.347 IGL02952 2 91208443 T C Het phenotype 12/18/2015
39 407077 APN Acpp 0.132 IGL02994 9 104309403 T A Het phenotype 08/02/2016
40 300139 APN Acsf2 0.000 IGL02602 11 94570465 A G Het phenotype 04/16/2015
41 103477 APN Acy1 0.136 IGL01670 G1 9 106436807 A C Het phenotype 01/21/2014
42 282251 APN Adam33 0.000 IGL02156 2 131053158 G A Het phenotype 04/16/2015
43 302089 APN Adamts17 0.161 IGL02649 7 66849878 T G Het phenotype 04/16/2015
44 304585 APN Adamts17 0.161 IGL02711 7 67052040 G A Het phenotype 04/16/2015
45 306477 APN Adamts18 0.230 IGL02756 8 113714344 C A Het phenotype 04/16/2015
46 407827 APN Adamts2 0.155 IGL03012 11 50776269 A G Het phenotype 08/02/2016
47 363492 APN Adamtsl5 0.046 IGL02898 10 80342231 A G Het 12/18/2015
48 419136 APN Adgrg1 0.000 IGL03109 8 95007676 T A Het phenotype 08/02/2016
49 282622 APN Adgrg6 1.000 IGL02164 10 14523555 T C Het phenotype 04/16/2015
50 296477 APN Adgrv1 0.000 IGL02508 13 81435556 A T Het phenotype 04/16/2015
51 363176 APN Adhfe1 0.183 IGL02891 1 9558171 T A Het phenotype 12/18/2015
52 293874 APN Adprhl2 0.249 IGL02391 4 126317908 C T Het phenotype 04/16/2015
53 412597 APN Adprhl2 0.249 IGL03189 4 126317294 T C Het phenotype 08/02/2016
54 297119 APN Aff4 1.000 IGL02526 11 53406682 T C Het phenotype 04/16/2015
55 284515 APN Agap3 0.439 IGL02207 5 24499936 A T Het 04/16/2015
56 417566 APN Ahcyl2 0.226 IGL03072 6 29906501 T C Het phenotype 08/02/2016
57 412799 APN Ahcyl2 0.226 IGL03195 6 29906769 T C Het phenotype 08/02/2016
58 409477 APN Ak8 0.407 IGL03061 2 28742755 T C Het phenotype 08/02/2016
59 413885 APN Ak8 0.407 IGL03230 2 28709923 A G Het phenotype 08/02/2016
60 415843 APN Akap10 0.264 IGL03289 11 61877968 A G Het phenotype 08/02/2016
61 414799 APN Akr1b8 0.356 IGL03260 6 34363459 G T Het phenotype 08/02/2016
62 420026 APN Alad 0.606 IGL03358 4 62510607 G A Het phenotype 08/02/2016
63 290981 APN Alyref 0.967 IGL02372 11 120594875 A G Het 04/16/2015
64 301582 APN Ampd1 0.280 IGL02637 3 103094883 T C Het phenotype 04/16/2015
65 293263 APN Amph 0.531 IGL02435 13 19139163 A G Het phenotype 04/16/2015
66 420999 APN Amz1 0.091 IGL03389 5 140752027 C A Het 08/02/2016
67 293781 APN Amz2 0.130 IGL02454 11 109434061 T G Het 04/16/2015
68 416355 APN Anapc1 0.964 IGL03304 2 128627113 A T Het phenotype 08/02/2016
69 420243 APN Angptl3 0.327 IGL03369 4 99034820 A T Het phenotype 08/02/2016
70 15374 UTSW Ank2 1.000 R0033 G1 Y 3 127104748 T A Het phenotype 12/17/2012
71 296879 APN Ankfn1 0.342 IGL02519 11 89405678 T C Het phenotype 04/16/2015
72 412311 APN Ankfy1 0.637 IGL03182 11 72728754 T C Het phenotype 08/02/2016
73 421336 APN Ankhd1 0.431 IGL03398 18 36656837 A G Het 08/02/2016
74 280841 APN Ankrd12 0.266 IGL02125 17 65970144 A G Het phenotype 04/16/2015
75 407073 APN Ankrd35 0.085 IGL02994 3 96682991 T C Het 08/02/2016
76 296358 APN Ano9 0.158 IGL02506 7 141102254 C T Het phenotype 04/16/2015
77 415511 APN Antxr1 0.000 IGL03278 6 87204457 A G Het phenotype 08/02/2016
78 414325 APN Anxa3 0.182 IGL03243 5 96828692 A T Het phenotype 08/02/2016
79 421238 APN Aox1 0.000 IGL03395 1 58068725 T C Het phenotype 08/02/2016
80 104059 APN Aox4 0.000 IGL01689 G1 1 58245161 A G Het phenotype 01/21/2014
81 279912 APN Aox4 0.000 IGL02104 1 58236657 T A Het phenotype 04/16/2015
82 365680 APN Ap1g2 0.315 IGL02967 14 55105022 T A Het phenotype 12/18/2015
83 360399 APN Ap5z1 0.191 IGL02805 5 142470283 G A Het phenotype 12/18/2015
84 283574 APN Apbb1 0.000 IGL02171 7 105559126 A G Het phenotype 04/16/2015
85 406309 APN Apc 0.987 IGL02974 18 34268383 C T Het phenotype 08/02/2016
86 305592 APN Apip 0.206 IGL02734 2 103089544 C T Het phenotype 04/16/2015
87 297254 APN Apobec3 0.000 IGL02529 15 79897687 C T Het phenotype 04/16/2015
88 417746 APN Appl2 0.183 IGL03077 10 83621759 C T Het phenotype 08/02/2016
89 299335 APN Aqp8 0.325 IGL02580 7 123466730 T C Het phenotype 04/16/2015
90 417844 APN Aqp8 0.325 IGL03080 7 123466579 T G Het phenotype 08/02/2016
91 406566 APN Aqr 1.000 IGL02981 2 114134824 T C Het phenotype 08/02/2016
92 286124 APN Araf 0.163 IGL02244 X 20853596 A G Het phenotype 04/16/2015
93 295380 APN Araf 0.163 IGL02484 X 20853909 A G Het phenotype 04/16/2015
94 304423 APN Arhgap22 0.662 IGL02707 14 33363272 C T Het phenotype 04/16/2015
95 288042 APN Arhgap26 0.165 IGL02316 18 38642546 C T Het phenotype 04/16/2015
96 299640 APN Arhgap26 0.165 IGL02588 18 38601617 G T Het phenotype 04/16/2015
97 300426 APN Arhgap6 0.000 IGL02609 X 169178066 A G Het phenotype 04/16/2015
98 102786 APN Arhgef18 0.200 IGL01649 G1 8 3441211 T A Het phenotype 01/21/2014
99 299496 APN Arhgef6 0.000 IGL02584 X 57246378 T G Het phenotype 04/16/2015
100 360682 APN Arhgef7 0.780 IGL02813 8 11800767 C T Het phenotype 12/18/2015
[records 1 to 100 of 415620] next >> last >|