Incidental Mutations

398,684 incidental mutations are currently displayed, and affect 22,353 genes.
62,271 are Possibly Damaging.
146,590 are Probably Damaging.
126,473 are Probably Benign.
37,952 are Probably Null.
16,344 create premature stop codons.
8,784 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 398684] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 192678 UTSW 1110017D15Rik 0.095 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.542 phenotype 05/23/2014
2 192500 UTSW 1700001C02Rik 0.165 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
3 243413 UTSW 1700001C19Rik 0.027 R2256 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
4 243483 UTSW 1700001C19Rik 0.027 R2257 G1 204 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 10/16/2014
5 273682 UTSW 1700001C19Rik 0.027 R3498 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
6 273727 UTSW 1700001C19Rik 0.027 R3499 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/02/2015
7 275564 UTSW 1700001C19Rik 0.027 R3834 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
8 275608 UTSW 1700001C19Rik 0.027 R3835 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/06/2015
9 308997 UTSW 1700001C19Rik 0.027 R3901 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
10 309355 UTSW 1700001C19Rik 0.027 R3910 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
11 309425 UTSW 1700001C19Rik 0.027 R3911 G1 215 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
12 309536 UTSW 1700001C19Rik 0.027 R3913 G1 217 Y 17 47433423 AC A critical splice acceptor site Het probably benign 0.051 04/17/2015
13 30249 UTSW 1700011E24Rik 0.091 R0364 G1 225 Y 17 87389714 T A critical splice acceptor site Het probably null 0.540 04/24/2013
14 388197 UTSW 1700017D01Rik 0.091 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.650 06/06/2016
15 478683 UTSW 1700019A02Rik 0.143 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
16 190952 UTSW 1700023F06Rik 0.039 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
17 501140 UTSW 1700049G17Rik 0.153 R5537 G1 217 N 7 27912246 TAATCTGTCTCCAAATCTG TAATCTG critical splice acceptor site Het probably benign 12/01/2017
18 39342 UTSW 1700067P10Rik 0.022 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.600 05/23/2013
19 100613 UTSW 2010111I01Rik 0.247 R1209 G1 225 N 13 63191064 A G critical splice acceptor site Het probably null phenotype 01/15/2014
20 379571 UTSW 2010111I01Rik 0.247 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.492 phenotype 04/15/2016
21 26543 UTSW 2010315B03Rik 0.159 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
22 60600 UTSW 2010315B03Rik 0.159 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
23 60571 UTSW 2010315B03Rik 0.159 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
24 22264 UTSW 2010315B03Rik 0.159 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
25 500098 UTSW 2010315B03Rik 0.159 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
26 31421 UTSW 2010315B03Rik 0.159 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
27 76984 UTSW 2010315B03Rik 0.159 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
28 76493 UTSW 2010315B03Rik 0.159 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
29 406142 UTSW 2310022A10Rik 0.203 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.486 07/28/2016
30 208042 UTSW 4430402I18Rik 0.110 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.486 06/23/2014
31 462735 UTSW 4833423E24Rik 0.100 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.644 03/01/2017
32 382658 UTSW 4921507P07Rik 0.117 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably benign 04/27/2016
33 318775 UTSW 4921524L21Rik 0.103 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
34 370200 UTSW 4930430A15Rik 0.054 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.476 02/04/2016
35 507928 UTSW 4930452B06Rik 0.131 R6280 G1 225.01 N 14 8473414 T G critical splice acceptor site Het probably null 03/15/2018
36 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
37 482208 UTSW 4930579C12Rik 0.116 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
38 511096 UTSW 4932438A13Rik 0.911 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
39 511596 UTSW 4932438A13Rik 0.911 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
40 212811 UTSW 4932438A13Rik 0.911 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
41 57694 UTSW 5430403G16Rik 0.163 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.520 07/11/2013
42 241496 UTSW 5430419D17Rik 0.126 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
43 241616 UTSW 5430419D17Rik 0.126 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
44 249756 UTSW 5830473C10Rik 0.289 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
45 381644 UTSW 9430076C15Rik R4957 G1 190 Y 6 53693922 A T critical splice acceptor site Het probably null 0.452 04/27/2016
46 376254 UTSW 9930111J21Rik1 0.162 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
47 166432 UTSW A430105I19Rik 0.064 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
48 391994 UTSW A530016L24Rik 0.023 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.644 06/08/2016
49 345326 UTSW A830018L16Rik 0.160 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
50 479514 UTSW A830018L16Rik 0.160 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.522 phenotype 06/26/2017
51 102103 UTSW Aak1 0.294 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
52 479868 UTSW Aanat 0.067 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.458 phenotype 06/26/2017
53 204589 UTSW Aass 0.399 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
54 489401 UTSW Abca13 0.166 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably null 0.480 phenotype 10/10/2017
55 349067 UTSW Abca6 0.108 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably null phenotype 10/08/2015
56 217018 UTSW Abca8a 0.113 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
57 486155 UTSW Abca8a 0.113 R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably null 08/16/2017
58 204725 UTSW Abca8b 0.317 R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 0.448 phenotype 06/23/2014
59 49312 UTSW Abcb1b 0.378 R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null 0.598 phenotype 06/12/2013
60 314451 UTSW Abcb4 0.000 R4112 G1 225 Y 5 8936783 A G critical splice acceptor site Het probably null 0.550 phenotype 05/14/2015
61 346036 UTSW Abcb5 0.287 R4606 G1 225 Y 12 118932610 T C critical splice acceptor site Het probably null 0.582 phenotype 09/25/2015
62 521932 UTSW Abcb6 0.602 R6527 G1 225.01 N 1 75177488 T C critical splice acceptor site Het probably null phenotype 06/06/2018
63 261898 UTSW Abcb9 0.231 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 0.568 phenotype 02/04/2015
64 275295 UTSW Abcc3 0.267 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null 0.564 phenotype 04/02/2015
65 448782 UTSW Abcc9 0.209 R5802 G1 225 Y 6 142656676 C A critical splice acceptor site Het probably null 0.568 phenotype 12/15/2016
66 22524 UTSW Abcd4 0.455 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 0.572 phenotype 04/16/2013
67 214910 UTSW Abcg8 0.000 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null 0.470 phenotype 07/14/2014
68 58394 UTSW Abhd12 0.361 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null 0.452 phenotype 07/11/2013
69 316602 UTSW Abhd12 0.361 R4077 G1 225 Y 2 150848459 T A critical splice acceptor site Het probably null 0.536 phenotype 05/15/2015
70 76737 UTSW Abi3bp 0.171 R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 0.454 10/16/2013
71 440160 UTSW Abtb2 0.285 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably null 0.466 11/08/2016
72 266910 UTSW Acaa1a 0.487 R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 0.564 phenotype 02/18/2015
73 48328 UTSW Acaca 1.000 R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
74 524617 UTSW Acaca 1.000 R6623 G1 225.01 N 11 84371499 A C critical splice acceptor site Het probably null phenotype 06/22/2018
75 326220 UTSW Acacb 0.000 R4386 G1 207 Y 5 114241921 A T critical splice acceptor site Het probably null 0.580 phenotype 07/06/2015
76 389143 UTSW Acadsb 0.147 R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 0.542 phenotype 06/06/2016
77 484254 UTSW Acap1 0.425 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably null 07/14/2017
78 330387 UTSW Accsl 0.100 R4472 G1 225 Y 2 93863991 T A critical splice acceptor site Het probably null 0.486 07/21/2015
79 209805 UTSW Aco1 0.505 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null 0.500 phenotype 06/30/2014
80 487573 UTSW Acsm2 0.074 R6129 G1 225.01 Y 7 119591247 G A critical splice acceptor site Het probably null 10/10/2017
81 523065 UTSW Acsm3 0.000 R6497 G1 225.01 N 7 119780749 G A critical splice acceptor site Het probably null phenotype 06/06/2018
82 157015 UTSW Actn1 0.532 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 0.566 phenotype 02/11/2014
83 402748 UTSW Actn2 0.678 R5228 G1 225 N 13 12288659 T C critical splice acceptor site Het probably null phenotype 07/22/2016
84 462619 UTSW Actn3 0.000 R5753 G1 225 Y 19 4864567 T C critical splice acceptor site Het probably null 0.508 phenotype 03/01/2017
85 43485 UTSW Adam32 0.191 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 0.464 phenotype 05/24/2013
86 36286 UTSW Adamts6 0.607 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null 0.530 phenotype 05/09/2013
87 427459 UTSW Adamtsl1 0.249 R5411 G1 225 N 4 86388413 G A critical splice acceptor site Het probably null phenotype 09/01/2016
88 42073 UTSW Adcy4 0.000 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably null 0.526 phenotype 05/23/2013
89 435084 UTSW Adgrb2 0.000 R5550 G1 225 N 4 130014934 G T critical splice acceptor site Het probably null phenotype 10/24/2016
90 357788 UTSW Adgrf3 0.124 R4754 G1 225 Y 5 30197617 T A critical splice acceptor site Het probably null 0.472 11/11/2015
91 168020 UTSW Adgrv1 0.000 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably null 0.452 phenotype 04/13/2014
92 200922 UTSW Adh1 0.000 R1464 G1 225 N 3 138288747 A G critical splice acceptor site Het probably null phenotype 05/23/2014
93 383896 UTSW Agfg2 0.149 R4965 G1 225 N 5 137667177 C A critical splice acceptor site Het probably null phenotype 04/27/2016
94 231044 UTSW Ago1 0.500 R2117 G1 225 N 4 126463857 T A critical splice acceptor site Het probably null phenotype 09/18/2014
95 449014 UTSW Ago2 1.000 R5815 G1 225 N 15 73107366 T C critical splice acceptor site Het probably null phenotype 12/20/2016
96 169062 UTSW Agr3 0.080 R1498 G1 225 Y 12 35934380 A T critical splice acceptor site Het probably null 0.594 phenotype 04/13/2014
97 401408 UTSW Aif1 0.362 R5260 G1 225 Y 17 35171941 T A critical splice acceptor site Het probably null 0.670 phenotype 07/06/2016
98 315783 UTSW Akap6 0.649 R4042 G1 195 N 12 53139379 A T critical splice acceptor site Het probably null phenotype 05/15/2015
99 241049 UTSW Akap8l 0.658 R2214 G1 225 N 17 32338825 T C critical splice acceptor site Het probably null 10/15/2014
100 44067 UTSW Akap8l 0.658 V5088 163 N 521 17 32336739 C G critical splice acceptor site Het probably null 05/31/2013
[records 1 to 100 of 398684] next >> last >|