Incidental Mutations

387,943 incidental mutations are currently displayed, and affect 22,308 genes.
60,170 are Possibly Damaging.
139,646 are Probably Damaging.
112,288 are Probably Benign.
39,439 are Probably Null.
15,728 create premature stop codons.
8,353 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 387943] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 512273 UTSW Ppl 0.000 R6088 G1 69.01 Y 16 5104988 L213Q A T missense Het possibly damaging 0.732 phenotype 04/19/2018
2 512272 UTSW Fat3 0.578 R5898 G1 73 Y 9 15938461 I3882V T C missense Het probably benign 0.149 phenotype 04/19/2018
3 512271 UTSW Jdp2 R6177 G1 65.01 Y 12 85638840 R125L G T missense Het probably benign 0.001 phenotype 04/19/2018
4 512270 UTSW Sirpb1c 0.034 R6177 G1 72.01 Y 3 15838758 T94K G T missense Het possibly damaging 0.726 04/19/2018
5 512269 UTSW Sox21 0.000 R6176 G1 64.01 Y 14 118235628 K3R T C missense Het possibly damaging 0.528 phenotype 04/19/2018
6 512268 UTSW Ptges3-ps 0.140 R6108 G1 135.01 Y 6 85844555 C T unclassified Het 04/19/2018
7 512267 UTSW Ebi3 0.000 R6133 G1 71.01 Y 17 55954311 V69E T A missense Het probably benign 0.317 phenotype 04/19/2018
8 512266 UTSW Ssrp1 1.000 R6133 G1 225.01 Y 2 85045339 T G exon Het phenotype 04/19/2018
9 512265 UTSW Rcor3 0.574 R6156 G1 103.01 Y 1 192127842 T A intron Het 04/19/2018
10 512264 UTSW S1pr4 1.000 R6132 G1 59.01 Y 10 81499196 A148V G A missense Het probably benign 0.016 phenotype 04/13/2018
11 512263 UTSW Muc4 0.170 U15987 G0' 54.01 Y 16 32754529 H1468N C A missense Het probably benign 0.015 0.119 04/12/2018
12 512262 UTSW Olfr723 0.102 R5254 G1 34 Y 14 49928779 I255N A T missense Het probably damaging 0.991 04/12/2018
13 512261 UTSW Nisch 0.161 R5254 G1 22 Y 14 31206567 R45Q C T missense Het probably null 04/12/2018
14 512260 UTSW Kmt2b 1.000 R5254 G1 67 Y 7 30569175 R2010C G A missense Het probably damaging 0.999 0.032 phenotype 04/12/2018
15 512259 UTSW Sp110 0.285 R5254 G1 28 Y 1 85577202 E109D G C missense Het unknown 0.061 04/12/2018
16 512258 UTSW Jph3 0.000 R6073 G1 58.01 Y 8 121753552 Y323F A T missense Het probably damaging 0.998 phenotype 04/12/2018
17 512257 UTSW Tmem59 0.121 R6073 G1 225.01 Y 4 107193401 T A intron 21 bp Het probably null 04/12/2018
18 512256 UTSW Ntrk1 1.000 R6073 G1 23.03 Y 3 87791370 T C splice site 4 bp Het probably null phenotype 04/12/2018
19 512255 UTSW Ihh 1.000 R6073 G1 56.01 Y 1 74951279 Q17R T C missense Het unknown phenotype 04/12/2018
20 512254 UTSW Gm17186 R6150 G1 84.01 Y 14 51680726 T C exon Het 04/12/2018
21 512253 UTSW Fxyd1 R6150 G1 225.01 Y 7 31054803 T C utr 5 prime Het noncoding transcript phenotype 04/12/2018
22 512252 UTSW Kmt2b 1.000 R6150 G1 68.01 Y 7 30588477 R81S G T missense Het unknown phenotype 04/12/2018
23 512251 UTSW E2f3 1.000 R5902 G1 21 Y 13 29985267 C T intron 33 bp Het probably null phenotype 04/12/2018
24 512250 UTSW Irf2bp1 0.601 R5902 G1 54 Y 7 19004447 V4A T C missense Het probably benign 0.066 04/12/2018
25 512249 UTSW Wnt5b 0.000 R5902 G1 54 Y 6 119448238 H6L T A missense Het probably benign 0.007 phenotype 04/12/2018
26 512248 UTSW Clic4 0.000 R5902 G1 70 Y 4 135272558 K11R T C missense Het probably benign 0.000 phenotype 04/12/2018
27 512247 UTSW Dnm1 0.599 R6135 G1 225.01 Y 2 32333063 T A splice site 3 bp Het probably null phenotype 04/12/2018
28 512246 UTSW Inpp5d 0.917 R6135 G1 185.01 Y 1 87620397 A G utr 5 prime Het probably null phenotype 04/12/2018
29 512245 UTSW Zfp534 0.314 R6157 G1 60.01 Y 4 147674490 R574K C T missense Het probably benign 0.000 04/12/2018
30 512244 UTSW Muc4 0.170 R6067 G1 54.01 Y 16 32754529 H1468N C A missense Het probably benign 0.015 0.119 04/12/2018
31 512243 UTSW Satl1 0.029 R6067 G1 225.01 Y X 112405916 T281A T C missense Het probably benign 0.000 04/12/2018
32 512242 UTSW Pgk1 0.909 R6067 G1 225.01 Y X 106194492 L85I C A missense Het possibly damaging 0.789 0.350 04/12/2018
33 512241 UTSW Fam90a1b 0.048 R6067 G1 225.01 Y X 94356585 N213S T C missense Het probably benign 0.235 0.138 04/12/2018
34 512236 UTSW Muc4 0.170 R6067 G1 225.01 Y 16 32755247 I1707N T A missense Het unknown 04/12/2018
35 512235 UTSW Tns2 0.099 R6067 G1 205.01 Y 15 102108934 R281C C T missense Het probably damaging 1.000 0.344 phenotype 04/12/2018
36 512233 UTSW Insm2 0.147 R6067 G1 153.01 Y 12 55600014 I181T T C missense Het probably damaging 0.999 0.196 04/12/2018
37 512228 UTSW Kitl 0.554 R6067 G1 225.01 Y 10 100076906 G A critical splice donor site 1 bp Het probably null 0.578 phenotype 04/12/2018
38 512227 UTSW Theg 0.428 R6067 G1 200.01 Y 10 79584755 S183P A G missense Het probably damaging 1.000 0.084 phenotype 04/12/2018
39 512223 UTSW Cbfa2t3 0.000 R6067 G1 225.01 Y 8 122643497 H53R T C missense Het probably benign 0.001 phenotype 04/12/2018
40 512222 UTSW Zfp1 0.137 R6067 G1 225.01 Y 8 111670343 F332S T C missense Het probably damaging 0.999 04/12/2018
41 512220 UTSW Adam39 0.044 R6067 G1 225.01 N 8 40824593 A7V C T missense Het probably benign 0.007 04/12/2018
42 512212 UTSW Tbx5 0.922 R6067 G1 225.01 Y 5 119883146 S406P T C missense Het probably benign 0.000 phenotype 04/12/2018
43 512211 UTSW Nop14 0.948 R6067 G1 225.01 Y 5 34657951 D85G T C missense Het probably damaging 0.998 04/12/2018
44 512208 UTSW Rad23b 1.000 R6067 G1 225.01 Y 4 55370400 A142V C T missense Het probably damaging 0.972 phenotype 04/12/2018
45 512203 UTSW Tex9 0.056 R6149 G1 225.01 Y 9 72462000 C T splice site Het probably null 04/11/2018
46 512202 UTSW Gm15264 R6149 G1 225.01 Y 3 94733429 C A splice site Het unknown 04/11/2018
47 512201 UTSW Gm18358 R5977 G1 55.01 Y 7 85090548 A G splice site Het unknown 04/11/2018
48 512200 UTSW Ugt1a6b 0.170 R5977 G1 44.01 Y 1 88216260 R403C C T missense Het probably damaging 1.000 0.522 04/11/2018
49 512199 UTSW Smyd5 0.228 R6114 G1 106.01 Y 6 85440262 A T exon Het 04/11/2018
50 512198 UTSW Tnxb 0.000 R5896 G1 72 Y 17 34672152 G490R G A missense Het probably damaging 1.000 phenotype 04/11/2018
51 512197 UTSW Otub2 0.110 R5896 G1 43 Y 12 103403428 T312M C T missense Het noncoding transcript 04/11/2018
52 512196 UTSW Irx3 0.000 R5896 G1 79 Y 8 91801135 S36G T C missense Het probably benign 0.000 phenotype 04/11/2018
53 512195 UTSW Crebzf 0.695 R5896 G1 100 Y 7 90443271 TGGAGGAGGAGGAGGAGGA TGGAGGAGGAGGAGGA small deletion Het probably benign 04/11/2018
54 512194 UTSW Wdr66 0.344 R6000 G1 57.01 Y 5 123254372 K190E A G missense Het unknown 0.060 04/11/2018
55 512193 UTSW Egf 0.000 R4992 G1 225 N 3 129711530 T C intron Het probably null phenotype 04/10/2018
56 512192 UTSW Gm29106 0.177 R4991 G1 87 N 1 118178391 M37T T C missense Het probably benign 0.011 04/10/2018
57 512191 UTSW Olfr1229 0.076 R4990 G1 155 N 2 89283327 A T intron Het probably null 04/10/2018
58 512190 UTSW Rpl41 0.102 R4989 G1 225 N 10 128548783 G T intron Het probably null 04/10/2018
59 512189 UTSW Supt20 0.969 R4989 G1 225 N 3 54695134 A T critical splice donor site Het unknown phenotype 04/10/2018
60 512188 UTSW Gm5678 R4988 G1 225 N 16 93629996 T162A A G missense Het probably benign 0.000 04/10/2018
61 512187 UTSW Casc3 1.000 R4988 G1 190 N 11 98821874 T G intron Het probably null 04/10/2018
62 512186 UTSW Gm4553 R4988 G1 225 N 7 142164992 S233L G A missense Het unknown 04/10/2018
63 512185 UTSW Lrba 0.327 R4985 G1 118 N 3 86327436 A G intron Het probably null 04/10/2018
64 512184 UTSW Gm29106 0.177 R4985 G1 212 N 1 118199220 D214V A T missense Het probably benign 0.017 04/10/2018
65 512183 UTSW Pifo 1.000 R4984 G1 221 N 3 106001494 T A start gained Het unknown phenotype 04/10/2018
66 512182 UTSW Peg10 1.000 R4983 G1 194 N 6 4756451 T TCCG small insertion Het unknown phenotype 04/10/2018
67 512181 UTSW Unc80 0.920 R4983 G1 135 N 1 66674732 G T intron Het probably null 04/10/2018
68 512180 UTSW 4932415D10Rik 0.115 R5017 G1 225 N 10 82296676 F167I A T missense Het unknown 04/10/2018
69 512179 UTSW Adprhl1 0.052 R5016 G1 192 N 8 13224889 L623P A G missense Het possibly damaging 0.924 04/10/2018
70 512178 UTSW D13Ertd608e R5015 G1 219 N 13 119836938 T A intron Het probably null 04/10/2018
71 512177 UTSW Peg10 1.000 R5015 G1 114 N 6 4756453 C CTCA small insertion Het unknown phenotype 04/10/2018
72 512176 UTSW Cbl 0.000 R5014 G1 184 N 9 44154399 T C intron Het probably null phenotype 04/10/2018
73 512175 UTSW Tyk2 0.000 R5014 G1 191 N 9 21115830 C T splice site Het probably null phenotype 04/10/2018
74 512174 UTSW Olfr22-ps1 R4997 G1 225 N 11 73954786 L32Q T A missense Het not run 04/10/2018
75 512173 UTSW Gm5136 R4997 G1 225 N 10 108699788 I102T A G missense Het probably benign 0.004 04/10/2018
76 512172 UTSW Olfr839-ps1 R4997 G1 93 N 9 19175331 L115Q A T missense Het probably damaging 1.000 04/10/2018
77 512171 UTSW Peg10 1.000 R4997 G1 132 N 6 4756457 TCAGGATCC TCAGGATCCCCAGCAGGATCC small insertion Het unknown phenotype 04/10/2018
78 512170 UTSW Peg10 1.000 R4996 G1 103 N 6 4756454 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC small insertion Het probably benign phenotype 04/10/2018
79 512169 UTSW Muc4 0.170 R4995 G1 215 N 16 32754041 S1306T T A missense Het probably benign 0.015 04/10/2018
80 512168 UTSW Mypn 0.258 R4995 G1 206 N 10 63119968 T C intron Het probably null 04/10/2018
81 512167 UTSW Rsf1 0.410 R4994 G1 217 N 7 97579909 G GACGGCGGCT small insertion Het probably benign 04/10/2018
82 512166 UTSW Slc12a5 1.000 R4994 G1 189 N 2 164983365 T A intron Het probably null phenotype 04/10/2018
83 512165 UTSW Olfr501-ps1 R4993 G1 225 N 7 108508243 M62I G A missense Het not run 04/10/2018
84 512164 UTSW Olfr501-ps1 R4982 G1 216 N 7 108508648 Y197* T A nonsense Het probably null 04/10/2018
85 512163 UTSW Peg10 1.000 R4982 G1 102 N 6 4756451 T TCCG small insertion Het unknown phenotype 04/10/2018
86 512162 UTSW Ephb1 0.000 R4981 G1 225 N 9 102040960 I450N A T missense Het probably benign 0.000 phenotype 04/10/2018
87 512161 UTSW Mycbp2 1.000 R4980 G1 102 N 14 103260385 A T intron Het probably null phenotype 04/10/2018
88 512160 UTSW Gm7298 0.139 R4980 G1 98 N 6 121759239 A G intron Het probably null 04/10/2018
89 512159 UTSW Iws1 0.960 R4979 G1 225 N 18 32093267 L187P T C missense Het not run 04/10/2018
90 512158 UTSW Rsf1 0.410 R4979 G1 214 N 7 97579907 GCG GCGACGGCGCCG small insertion Homo unknown 04/10/2018
91 512157 UTSW Thap1 0.873 R4978 G1 174 N 8 26160854 AGCAGCATCTGCTCG AG frame shift Het probably null 04/10/2018
92 512156 UTSW Gm7298 0.139 R4978 G1 225 N 6 121733117 T G critical splice donor site 2 bp Het probably null 04/10/2018
93 512155 UTSW Mogat2 0.000 R6256 G1 225.01 N 7 99219895 H305Q A T missense Het probably damaging 1.000 phenotype 04/05/2018
94 512154 UTSW Nlrp1b 0.000 R6250 G1 225.01 N 11 71181799 I406N A T missense Het probably benign 0.114 phenotype 04/05/2018
95 512153 UTSW Olfr417 0.122 R6246 G1 225.01 N 1 174369670 V251G T G missense Het not run 04/05/2018
96 512152 UTSW Thap1 0.873 R6242 G1 217.47 N 8 26160856 CAGCATCTGCTCGGAGCA CAGCA frame shift Het probably null 04/05/2018
97 512151 UTSW Mrps27 0.891 R6241 G1 225.01 N 13 99412246 T297A A G missense Het probably benign 0.000 0.118 04/05/2018
98 512150 UTSW Thap1 0.873 R6237 G1 174.47 N 8 26160856 CAGCATCTGCTCGGAGCA CAGCA frame shift Het probably null 04/05/2018
99 512149 UTSW Las1l FR4548 204.47 N X 95940823 GAG GAGAAG small insertion Het unknown 04/05/2018
100 512148 UTSW Las1l FR4548 217.47 N X 95940625 TC TCTTCCGC small insertion Het unknown 04/05/2018
[records 1 to 100 of 387943] next >> last >|