Incidental Mutations

386,654 incidental mutations are currently displayed, and affect 23,517 genes.
56,669 are Possibly Damaging.
123,087 are Probably Damaging.
133,398 are Probably Benign.
35,731 are Probably Null.
16,692 create premature stop codons.
6,060 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 386654] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 475444 UTSW Stxbp5 R5285 G1 225 Y 10 9798275 T C critical splice acceptor site Het probably null phenotype 04/21/2017
2 475443 UTSW Olfr645 R5285 G1 225 Y 7 104084133 *316R A G makesense Het probably null 04/21/2017
3 475442 UTSW Wdr90 R5287 G1 46 Y 17 25861467 C3* A T nonsense Het probably null 04/20/2017
4 475441 UTSW Snrnp200 R5287 G1 225 Y 2 127231687 V1335A T C missense Het probably benign 0.131 phenotype 04/20/2017
5 475440 UTSW Celf1 R5287 G1 225 Y 2 91009207 S299P T C missense Het possibly damaging 0.827 phenotype 04/20/2017
6 475439 UTSW Cd46 R5287 G1 225 Y 1 195062411 C253Y C T missense Het possibly damaging 0.655 phenotype 04/20/2017
7 475438 UTSW Sp140 R5287 G1 42 Y 1 85610824 R94Q G A missense Het probably null 04/20/2017
8 475437 UTSW Pcm1 R5470 G1 225 Y 8 41287683 W950R T A missense Het probably damaging 0.999 04/20/2017
9 475436 UTSW Dnah10 R5470 G1 225 Y 5 124753168 N709D A G missense Het probably benign 0.000 04/20/2017
10 475435 UTSW Gm14129 R5470 G1 225 Y 2 148927817 G T splice site Het unknown 04/20/2017
11 475434 UTSW Mink1 R5310 G1 225 Y 11 70607343 V149A T C missense Het probably benign 0.326 04/19/2017
12 475433 UTSW Ap2a1 R5310 G1 225 Y 7 44906065 A G unclassified Het probably null 04/19/2017
13 475432 UTSW Tap2 R5262 G1 225 N 17 34214016 T500A A G missense Het not run phenotype 04/19/2017
14 475431 UTSW Haus8 R5294 G1 225 Y 8 71255710 I153T A G missense Het noncoding transcript 04/19/2017
15 475430 UTSW Zgrf1 R5294 G1 225 Y 3 127600980 V637I G A missense Het probably benign 0.145 04/19/2017
16 475429 UTSW Ube2c R5294 G1 225 Y 2 164777190 V161A T C missense Het probably benign 0.000 04/19/2017
17 475428 UTSW Gnpda1 R4059 G1 225 N 18 38333215 P62L G A missense Het noncoding transcript 04/14/2017
18 475427 UTSW Pcdha2 R4059 G1 225 N 18 36939882 S189G A G missense Het probably benign 0.070 04/14/2017
19 475426 UTSW Dlg4 R4059 G1 162 N 11 70027083 L64P T C missense Het probably benign 0.000 phenotype 04/14/2017
20 475425 UTSW Tab2 R4059 G1 225 N 10 7907507 H184Y G A missense Het noncoding transcript phenotype 04/14/2017
21 475424 UTSW Actn4 R4059 G1 127 N 7 28895498 T541A T C missense Het noncoding transcript phenotype 04/14/2017
22 475423 UTSW Tmc4 R4059 G1 136 N 7 3675081 S152P A G missense Het noncoding transcript 04/14/2017
23 475422 UTSW Dennd2c R4059 G1 225 N 3 103156915 S191* C A nonsense Het probably null 04/14/2017
24 475421 UTSW Pygo2 R4059 G1 225 N 3 89432704 S134P T C missense Het noncoding transcript phenotype 04/14/2017
25 475420 UTSW Gnpda1 R4058 G1 225 N 18 38333215 P62L G A missense Het noncoding transcript 04/14/2017
26 475419 UTSW Pcdha2 R4058 G1 225 N 18 36939882 S189G A G missense Het probably benign 0.070 04/14/2017
27 475418 UTSW Dlgap5 R4058 G1 225 N 14 47405900 T400A T C missense Het noncoding transcript phenotype 04/14/2017
28 475417 UTSW Arhgap20 R4058 G1 225 N 9 51824955 V243A T C missense Het noncoding transcript 04/14/2017
29 475416 UTSW Cngb1 R4058 G1 225 N 8 95267654 E163G T C missense Het probably benign 0.004 phenotype 04/14/2017
30 475415 UTSW Tmc4 R4058 G1 206 N 7 3675081 S152P A G missense Het noncoding transcript 04/14/2017
31 475414 UTSW Ift22 R4058 G1 225 N 5 136911863 P84Q C A missense Het not run 04/14/2017
32 475413 UTSW Ccdc141 R4058 G1 225 N 2 77045273 *789W T C makesense Het noncoding transcript 04/14/2017
33 475412 UTSW Ighv1-30 R4057 G1 225 N 12 114817401 G16D C T missense Het noncoding transcript 04/14/2017
34 475411 UTSW 1700039E15Rik R4057 G1 225 N 7 45287227 D31G A G missense Het noncoding transcript 04/14/2017
35 475410 UTSW 9930104L06Rik R4057 G1 225 N 4 124938602 S120G A G missense Het noncoding transcript 04/14/2017
36 475409 UTSW Gria2 R4057 G1 225 N 3 80702599 S770F G A missense Het noncoding transcript phenotype 04/14/2017
37 475408 UTSW Vmn2r7 R4057 G1 225 N 3 64719462 S414P A G missense Het noncoding transcript 04/14/2017
38 475407 UTSW Dst R4057 G1 225 N 1 34152513 V308G T G missense Het noncoding transcript phenotype 04/14/2017
39 475406 UTSW 1700001L05Rik R4056 G1 225 N 15 83358143 L563F G A missense Het noncoding transcript 04/14/2017
40 475405 UTSW Ighv1-30 R4056 G1 225 N 12 114817401 G16D C T missense Het noncoding transcript 04/14/2017
41 475404 UTSW Ighv1-18 R4056 G1 225 N 12 114682667 T106A T C missense Het probably benign 0.264 04/14/2017
42 475403 UTSW Myo18a R4056 G1 225 N 11 77812013 E5G A G missense Het possibly damaging 0.719 04/14/2017
43 475402 UTSW 1700039E15Rik R4056 G1 225 N 7 45287227 D31G A G missense Het noncoding transcript 04/14/2017
44 475401 UTSW Mgam2-ps R4056 G1 225 N 6 40845743 E1034D A T missense Het noncoding transcript 04/14/2017
45 475400 UTSW Fancg R4056 G1 225 N 4 43010121 V17A A G missense Het noncoding transcript phenotype 04/14/2017
46 475399 UTSW Trav7-3 R4052 225 N 14 53443746 T82A A G missense Het probably benign 0.325 04/14/2017
47 475398 UTSW Tamm41 R4052 217 N 6 115012359 AGGG AGG frame shift Het probably null 04/14/2017
48 475397 UTSW Cyp4a30b R4052 225 N 4 115454342 D69G A G missense Het probably benign 0.005 04/14/2017
49 475396 UTSW Dclk2 R4052 209 N 3 86830822 A G critical splice donor site Het probably null 04/14/2017
50 475395 UTSW Trav7-3 R4051 225 N 14 53443746 T82A A G missense Het probably benign 0.325 04/14/2017
51 475394 UTSW Ibtk R4051 225 N 9 85690708 F1261S A G missense Het noncoding transcript phenotype 04/14/2017
52 475393 UTSW Rfx7 R4051 225 N 9 72611863 P492L C T missense Het noncoding transcript 04/14/2017
53 475392 UTSW Tamm41 R4051 139 N 6 115012359 AGGG AGG frame shift Het probably null 04/14/2017
54 475391 UTSW Dclk2 R4051 225 N 3 86830822 A G critical splice donor site Het probably null 04/14/2017
55 475390 UTSW Sycp2 R4051 225 N 2 178355040 H455L T A missense Het noncoding transcript phenotype 04/14/2017
56 475389 UTSW Asxl1 R4051 222 N 2 153393434 F54S T C missense Het noncoding transcript phenotype 04/14/2017
57 475388 UTSW Ankzf1 R4051 225 N 1 75198143 D872G A G missense Het noncoding transcript 04/14/2017
58 475387 UTSW Samd15 R4050 G1 225 N 12 87200632 N30K T G missense Het probably benign 0.001 04/14/2017
59 475386 UTSW Wdr17 R4050 G1 225 N 8 54645343 Y77F T A missense Het noncoding transcript 04/14/2017
60 475385 UTSW Kazn R4050 G1 225 N 4 142106904 E614K C T missense Het not run 04/14/2017
61 475384 UTSW Rtel1 R4050 G1 225 N 2 181339137 M9I G A missense Het noncoding transcript phenotype 04/14/2017
62 475383 UTSW D430041D05Rik R4050 G1 163 N 2 104205122 S364P A G missense Het noncoding transcript 04/14/2017
63 475382 UTSW Kdm5d R4049 G1 222 N Y 942458 F1039L T C missense Homo noncoding transcript 04/14/2017
64 475381 UTSW Tnks2 R4049 G1 225 N 19 36845583 M128T T C missense Het noncoding transcript phenotype 04/14/2017
65 475380 UTSW Pcdha9 R4049 G1 225 N 18 36997942 H21Q T A missense Het probably benign 0.161 04/14/2017
66 475379 UTSW Gm7358 R4049 G1 225 N 17 14058891 Y214F T A missense Het noncoding transcript 04/14/2017
67 475378 UTSW Ear-ps2 R4049 G1 225 N 14 44047318 G112* G T nonsense Het probably null 04/14/2017
68 475377 UTSW Cdhr4 R4049 G1 225 N 9 107996042 Y72* T A nonsense Het probably null 04/14/2017
69 475376 UTSW Trbv31 R4049 G1 225 N 6 41557705 C107F C A missense Het probably damaging 1.000 04/14/2017
70 475375 UTSW Hgfac R4049 G1 206 N 5 35047076 G86V G T missense Het noncoding transcript phenotype 04/14/2017
71 475374 UTSW Tlk1 R4049 G1 225 N 2 70770016 T72I G A missense Het noncoding transcript 04/14/2017
72 475373 UTSW Olfr192 R4044 G1 225 N 16 59098761 P77S G A missense Het noncoding transcript 04/14/2017
73 475372 UTSW Gm12183 R4044 G1 225 N 11 48752549 H389L T A missense Het noncoding transcript 04/14/2017
74 475371 UTSW Pcsk4 R4044 G1 225 N 10 80325728 N211S T C missense Het noncoding transcript phenotype 04/14/2017
75 475370 UTSW Lgals4 R4044 G1 225 N 7 28841122 H39Q T A missense Het noncoding transcript 04/14/2017
76 475369 UTSW Epha2 R4044 G1 145 N 4 141320620 TATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATT TATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATTCATT frame shift Homo probably null phenotype 04/14/2017
77 475368 UTSW Selenbp2 R4044 G1 225 N 3 94703742 P231S C T missense Het noncoding transcript 04/14/2017
78 475367 UTSW Pced1a R4044 G1 213 N 2 130419080 D1080G T C missense Het noncoding transcript 04/14/2017
79 475366 UTSW Trp53i11 R4044 G1 225 N 2 93199034 S269T T A missense Het noncoding transcript 04/14/2017
80 475365 UTSW Hdac6 R4043 G1 222 N X 7931492 T993A T C missense Homo probably benign 0.044 phenotype 04/14/2017
81 475364 UTSW Olfr192 R4043 G1 225 N 16 59098761 P77S G A missense Het noncoding transcript 04/14/2017
82 475363 UTSW Rnf157 R4043 G1 167 N 11 116345929 Q66* G A nonsense Het probably null 04/14/2017
83 475362 UTSW Gga3 R4043 G1 225 N 11 115589035 S7R A T missense Het noncoding transcript phenotype 04/14/2017
84 475361 UTSW Lgals4 R4043 G1 225 N 7 28841122 H39Q T A missense Het noncoding transcript 04/14/2017
85 475360 UTSW Ptprf R4043 G1 225 N 4 118213553 S265P A G missense Het noncoding transcript phenotype 04/14/2017
86 475359 UTSW Smim8 R4043 G1 225 N 4 34771234 L145S A G missense Het noncoding transcript 04/14/2017
87 475358 UTSW Selenbp2 R4043 G1 225 N 3 94703742 P231S C T missense Het noncoding transcript 04/14/2017
88 475357 UTSW Atf2 R4043 G1 225 N 2 73829909 S402P A G missense Het noncoding transcript phenotype 04/14/2017
89 475356 UTSW R3hcc1 R4041 G1 225 N 14 69706662 L24P A G missense Het probably damaging 0.998 04/14/2017
90 475355 UTSW Lsp1 R4041 G1 129 N 7 142472317 H149L A T missense Het noncoding transcript phenotype 04/14/2017
91 475354 UTSW Golim4 R4041 G1 225 N 3 75911594 T199A T C missense Het noncoding transcript 04/14/2017
92 475353 UTSW Naaladl2 R4041 G1 225 N 3 23846499 S210N C T missense Het noncoding transcript 04/14/2017
93 475352 UTSW Nfasc R4041 G1 201 N 1 132619456 G1080C C A missense Het noncoding transcript phenotype 04/14/2017
94 475351 UTSW Col11a2 R4039 G1 186 N 17 34045774 T268A A G missense Het probably benign 0.001 phenotype 04/14/2017
95 475350 UTSW Ube2g2 R4039 G1 225 N 10 77641550 D122G A G missense Het noncoding transcript 04/14/2017
96 475349 UTSW Ddx51 R4039 G1 225 N 5 110656671 T13A A G missense Het noncoding transcript 04/14/2017
97 475348 UTSW Gm15587 R4039 G1 225 N 5 24383521 R21P C G missense Het noncoding transcript 04/14/2017
98 475347 UTSW Dctn3 R4039 G1 156 N 4 41723133 N2S T C missense Het noncoding transcript 04/14/2017
99 475346 UTSW Cstf3 R4039 G1 225 N 2 104655661 M41K T A missense Het noncoding transcript 04/14/2017
100 475345 UTSW Pcdha8 R4038 G1 225 N 18 36992861 M132T T C missense Het probably benign 0.000 04/14/2017
[records 1 to 100 of 386654] next >> last >|