Incidental Mutations

387,911 incidental mutations are currently displayed, and affect 23,547 genes.
57,479 are Possibly Damaging.
124,853 are Probably Damaging.
132,985 are Probably Benign.
36,165 are Probably Null.
16,950 create premature stop codons.
6,290 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 387911] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 478250 UTSW Gm21064 LCD18 G1 66.1 Y Y 4381621 G424C G T missense Het not run 05/26/2017
2 478249 UTSW Asmt LCD18 G1 72.7 Y X 170673633 C T synonymous Het unknown phenotype 05/26/2017
3 478248 UTSW Gm21887 LCD18 G1 30.7 Y X 170005564 T A unclassified Het 05/26/2017
4 478247 UTSW Rps6ka3 LCD18 G1 999 Y X 159279215 A G intron Het phenotype 05/26/2017
5 478246 UTSW Btk LCD18 G1 999 Y X 134578825 T C intron Het phenotype 05/26/2017
6 478245 UTSW Gm14936 LCD18 G1 999 Y X 112998750 G A intron Het 05/26/2017
7 478244 UTSW Mageb18 LCD18 G1 999 Y X 92365090 C G intron Het 05/26/2017
8 478243 UTSW Aff2 LCD18 G1 999 Y X 69747535 C A intron Het phenotype 05/26/2017
9 478242 UTSW Bcorl1 LCD18 G1 999 Y X 48365620 T A intron Het 05/26/2017
10 478241 UTSW Atrnl1 LCD18 G1 999 Y 19 57773729 A C intron Het phenotype 05/26/2017
11 478240 UTSW Aldh1a1 LCD18 G1 999 Y 19 20626646 C A intron Het phenotype 05/26/2017
12 478239 UTSW Dcc LCD18 G1 999 Y 18 72297447 G A intron Het phenotype 05/26/2017
13 478238 UTSW Prr16 LCD18 G1 999 Y 18 51200324 C T intron Het 05/26/2017
14 478237 UTSW Slc25a46 LCD18 G1 999 Y 18 31597313 C A intron Het 05/26/2017
15 478236 UTSW Riok3 LCD18 G1 999 Y 18 12129982 G T intron Het 05/26/2017
16 478235 UTSW Cntnap5c LCD18 G1 999 Y 17 58162160 G C intron Het 05/26/2017
17 478234 UTSW H2-T23 LCD18 G1 78.4 Y 17 36031216 T C synonymous Het unknown phenotype 05/26/2017
18 478233 UTSW Sbpl LCD18 G1 68.8 Y 17 23954617 G A synonymous Het unknown 05/26/2017
19 478232 UTSW Sbpl LCD18 G1 71.8 Y 17 23954616 A G synonymous Het unknown 05/26/2017
20 478231 UTSW App LCD18 G1 999 Y 16 85025412 C G splice site Het unknown phenotype 05/26/2017
21 478230 UTSW RP24-252G15.3 LCD18 G1 999 Y 16 77618281 G A synonymous Het unknown 05/26/2017
22 478229 UTSW Cadm2 LCD18 G1 999 Y 16 67205554 C T intron Het phenotype 05/26/2017
23 478228 UTSW 2610015P09Rik LCD18 G1 999 Y 16 43921801 G A intron Het 05/26/2017
24 478227 UTSW Il1rap LCD18 G1 999 Y 16 26631593 C A intron Het phenotype 05/26/2017
25 478226 UTSW Krt81 LCD18 G1 999 Y 15 101461006 G A synonymous Het unknown 05/26/2017
26 478225 UTSW 6030458C11Rik LCD18 G1 999 Y 15 12817993 G A synonymous Het unknown 05/26/2017
27 478224 UTSW Klhl1 LCD18 G1 999 Y 14 96317730 G C intron Het phenotype 05/26/2017
28 478223 UTSW Lrch1 LCD18 G1 999 Y 14 74905021 C T intron Het 05/26/2017
29 478222 UTSW Gm10371 LCD18 G1 103 Y 14 47097869 C T synonymous Het unknown 05/26/2017
30 478221 UTSW Ocln LCD18 G1 999 Y 13 100520567 C T intron Het phenotype 05/26/2017
31 478220 UTSW Mef2c LCD18 G1 999 Y 13 83605823 G A intron Het phenotype 05/26/2017
32 478219 UTSW Aaed1 LCD18 G1 119 Y 13 64287285 G A unclassified Het 05/26/2017
33 478218 UTSW Zfp808 LCD18 G1 999 Y 13 62166651 C T intron Het 05/26/2017
34 478217 UTSW Ofcc1 LCD18 G1 999 Y 13 40092967 G A intron Het phenotype 05/26/2017
35 478216 UTSW Nme8 LCD18 G1 999 Y 13 19678717 G A intron Het phenotype 05/26/2017
36 478215 UTSW Ighv5-9 LCD18 G1 999 Y 12 113661873 C T synonymous Het unknown 05/26/2017
37 478214 UTSW RP24-374C7.1 LCD18 G1 37 Y 12 113381411 Q51K G T missense Het not run 05/26/2017
38 478213 UTSW Ston2 LCD18 G1 999 Y 12 91717241 A T intron Het phenotype 05/26/2017
39 478212 UTSW 4930447C04Rik LCD18 G1 999 Y 12 72901715 C T intron Het 05/26/2017
40 478211 UTSW Dtd2 LCD18 G1 999 Y 12 51992921 T C intron Het 05/26/2017
41 478210 UTSW 3110053B16Rik LCD18 G1 67.6 Y 12 20876287 *453Q A G makesense Het not run 05/26/2017
42 478209 UTSW Arl16 LCD18 G1 999 Y 11 120469578 CTTTTTTT CTTTTTT unclassified Het 05/26/2017
43 478208 UTSW Ftsj3 LCD18 G1 999 Y 11 106250059 G T unclassified Het 05/26/2017
44 478207 UTSW Ttll6 LCD18 G1 999 Y 11 96155258 C T intron Het 05/26/2017
45 478206 UTSW Asic2 LCD18 G1 999 Y 11 80985744 C A intron Het phenotype 05/26/2017
46 478205 UTSW Gm12130 LCD18 G1 999 Y 11 38506923 T C intron Het 05/26/2017
47 478204 UTSW Gm4302 LCD18 G1 57.7 Y 10 100341444 W197R T C missense Het probably benign 0.196 05/26/2017
48 478203 UTSW Apc2 LCD18 G1 999 Y 10 80299974 G C intron Het phenotype 05/26/2017
49 478202 UTSW Unc5b LCD18 G1 999 Y 10 60786171 C G intron Het phenotype 05/26/2017
50 478201 UTSW Ptprk LCD18 G1 999 Y 10 28574987 T C intron Het 05/26/2017
51 478200 UTSW Mei4 LCD18 G1 999 Y 9 82186959 A G intron Het phenotype 05/26/2017
52 478199 UTSW Car12 LCD18 G1 999 Y 9 66761676 C A intron Het phenotype 05/26/2017
53 478198 UTSW Kmt2a LCD18 G1 999 Y 9 44877112 T C intron Het phenotype 05/26/2017
54 478197 UTSW Gm5615 LCD18 G1 999 Y 9 36533553 T C utr 3 prime Het 05/26/2017
55 478196 UTSW Ttc13 LCD18 G1 43.9 Y 8 124675866 S1028F G A missense Het not run 05/26/2017
56 478195 UTSW Clec18a LCD18 G1 999 Y 8 111076136 C A splice site Het unknown 05/26/2017
57 478194 UTSW A330008L17Rik LCD18 G1 999 Y 8 99723425 A G intron Het 05/26/2017
58 478193 UTSW Inpp4b LCD18 G1 999 Y 8 81693010 C T intron Het phenotype 05/26/2017
59 478192 UTSW Galntl6 LCD18 G1 999 Y 8 58698974 C A intron Het 05/26/2017
60 478191 UTSW Fgf20 LCD18 G1 999 Y 8 40292318 A C intron Het phenotype 05/26/2017
61 478190 UTSW Ccdc101 LCD18 G1 999 Y 7 126663354 G A intron Het 05/26/2017
62 478189 UTSW Gm8995 LCD18 G1 55.1 Y 7 106507559 C T synonymous Het unknown 05/26/2017
63 478188 UTSW Nox4 LCD18 G1 999 Y 7 87243067 A G unclassified Het phenotype 05/26/2017
64 478187 UTSW Apba2 LCD18 G1 999 Y 7 64622160 A T intron Het phenotype 05/26/2017
65 478186 UTSW Gm9271 LCD18 G1 69.1 Y 7 39363578 K534* T A nonsense Het probably null 05/26/2017
66 478185 UTSW Gm9127 LCD18 G1 65.7 Y 7 32059392 C T synonymous Het unknown 05/26/2017
67 478184 UTSW Crxos LCD18 G1 999 Y 7 15894613 T A intron Het 05/26/2017
68 478183 UTSW Cntn4 LCD18 G1 999 Y 6 106553940 A G intron Het phenotype 05/26/2017
69 478182 UTSW Mxd1 LCD18 G1 999 Y 6 86667406 T C intron Het phenotype 05/26/2017
70 478181 UTSW C130060K24Rik LCD18 G1 999 Y 6 65450349 C A intron Het 05/26/2017
71 478180 UTSW Gm16630 LCD18 G1 999 Y 6 48141269 C T intron Het 05/26/2017
72 478179 UTSW Lsm8 LCD18 G1 999 Y 6 18854321 G A synonymous Het unknown 05/26/2017
73 478178 UTSW Gm26809 LCD18 G1 28.9 Y 6 18844316 G33S G A missense Het not run 05/26/2017
74 478177 UTSW Cyp3a16 LCD18 G1 241 Y 5 145465038 C T synonymous Het unknown 05/26/2017
75 478176 UTSW Baz1b LCD18 G1 999 Y 5 135222058 G T synonymous Het unknown phenotype 05/26/2017
76 478175 UTSW Nos1 LCD18 G1 999 Y 5 117943253 C A synonymous Het unknown phenotype 05/26/2017
77 478174 UTSW 1700007G11Rik LCD18 G1 999 Y 5 98707508 G A intron Het 05/26/2017
78 478173 UTSW Tbc1d19 LCD18 G1 999 Y 5 53816709 A C intron Het 05/26/2017
79 478172 UTSW Magi2 LCD18 G1 999 Y 5 19954511 T C intron Het phenotype 05/26/2017
80 478171 UTSW Ski LCD18 G1 60.4 Y 4 155155894 G901D C T missense Het not run phenotype 05/26/2017
81 478170 UTSW Spsb1 LCD18 G1 999 Y 4 149952486 C T intron Het 05/26/2017
82 478169 UTSW Gm13151 LCD18 G1 72.4 Y 4 147331682 K191T A C missense Het possibly damaging 0.784 05/26/2017
83 478168 UTSW Gm13135 LCD18 G1 45.4 Y 4 147277152 K393E A G missense Het not run 05/26/2017
84 478167 UTSW Gm13135 LCD18 G1 66 Y 4 147277142 G A synonymous Het unknown 05/26/2017
85 478166 UTSW Gm13234 LCD18 G1 117 Y 4 145632716 T C synonymous Het unknown 05/26/2017
86 478165 UTSW Mtf1 LCD18 G1 999 Y 4 124829316 A G intron Het phenotype 05/26/2017
87 478164 UTSW Dab1 LCD18 G1 999 Y 4 104046572 T G intron Het phenotype 05/26/2017
88 478163 UTSW Cpne3 LCD18 G1 999 Y 4 19563382 G T intron Het 05/26/2017
89 478162 UTSW Negr1 LCD18 G1 999 Y 3 156671032 G T intron Het phenotype 05/26/2017
90 478161 UTSW Dapp1 LCD18 G1 999 Y 3 137939400 G A intron Het phenotype 05/26/2017
91 478160 UTSW RP23-199D18.4 LCD18 G1 43.6 Y 3 93873859 D176E A T missense Het not run 05/26/2017
92 478159 UTSW Nbea LCD18 G1 999 Y 3 55701527 G T intron Het phenotype 05/26/2017
93 478158 UTSW Gm14266 LCD18 G1 999 Y 2 171261548 A G intron Het 05/26/2017
94 478157 UTSW Zfp442 LCD18 G1 999 Y 2 150419848 C T intron Het 05/26/2017
95 478156 UTSW Mpped2 LCD18 G1 999 Y 2 106721428 C A intron Het 05/26/2017
96 478155 UTSW Kcnh7 LCD18 G1 999 Y 2 63049799 A G intron Het 05/26/2017
97 478154 UTSW Lrp1b LCD18 G1 999 Y 2 42237562 G C intron Het phenotype 05/26/2017
98 478153 UTSW Pdss1 LCD18 G1 999 Y 2 22900968 C T intron Het 05/26/2017
99 478152 UTSW Marc2 LCD18 G1 999 Y 1 184822788 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA intron Het 05/26/2017
100 478151 UTSW Rgs16 LCD18 G1 999 Y 1 153744230 G A utr 3 prime Het phenotype 05/26/2017
[records 1 to 100 of 387911] next >> last >|