Incidental Mutations

399,610 incidental mutations are currently displayed, and affect 23,668 genes.
58,691 are Possibly Damaging.
136,012 are Probably Damaging.
110,415 are Probably Benign.
38,446 are Probably Null.
17,429 create premature stop codons.
5,918 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 399610] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 490739 UTSW Adamts20 R5801 G1 225 N 15 94347670 E584* C A nonsense Het probably null phenotype 10/24/2017
2 490738 UTSW Stk10 R5801 G1 225 N 11 32596748 P335L C T missense Het probably benign 0.004 phenotype 10/24/2017
3 490737 UTSW Adam15 R5801 G1 225 N 3 89342361 V667I C T missense Het probably damaging 0.999 phenotype 10/24/2017
4 490736 APN Col23a1 IGL03493 11 51564805 T C unclassified Het 10/20/2017
5 490735 APN Map4k1 IGL03493 7 28984151 A T unclassified Het phenotype 10/20/2017
6 490734 APN Trav2 IGL03493 14 52567288 A G utr 5 prime Het 10/20/2017
7 490733 APN Cyp4a31 IGL03493 4 115570755 T A unclassified Het 10/20/2017
8 490732 APN Col9a1 IGL03493 1 24221570 T A unclassified Het phenotype 10/20/2017
9 490731 APN Hsf2 IGL03493 10 57505366 I351F A T missense Het probably damaging 0.999 phenotype 10/20/2017
10 490730 APN Ampd2 IGL03493 3 108075358 E720G T C unclassified Het probably damaging 1.000 phenotype 10/20/2017
11 490729 APN Matn1 IGL03493 4 130949998 R173G A G missense Het probably benign 0.365 phenotype 10/20/2017
12 490728 APN Nyap1 IGL03493 5 137735016 I585T A G missense Het probably damaging 0.998 10/20/2017
13 490727 APN Atcay IGL03493 10 81210573 E306* C A nonsense Het probably null phenotype 10/20/2017
14 490726 APN Ezh1 IGL03493 11 101203791 T395A T C missense Het probably benign 0.023 phenotype 10/20/2017
15 490725 APN Podnl1 IGL03493 8 84132189 V548I G A missense Het possibly damaging 0.606 10/20/2017
16 490724 APN Lnpep IGL03493 17 17579171 A74E G T missense Het probably damaging 1.000 phenotype 10/20/2017
17 490723 APN Phactr2 IGL03493 10 13257669 V190A A G missense Het probably benign 0.019 10/20/2017
18 490722 APN Kif20b IGL03493 19 34959550 C1448* T A nonsense Het probably null phenotype 10/20/2017
19 490721 APN Atp13a5 IGL03493 16 29297524 D591E G T missense Het probably benign 0.000 10/20/2017
20 490720 APN Sec63 IGL03493 10 42828941 D730E C A missense Het probably benign 0.065 phenotype 10/20/2017
21 490719 APN Rad51c IGL03493 11 87397753 H183Q A T missense Het probably benign 0.001 phenotype 10/20/2017
22 490718 APN Dnah11 IGL03493 12 118012798 R2708C G A missense Het probably benign 0.002 phenotype 10/20/2017
23 490717 APN Smarcc2 IGL03493 10 128461357 I39M A G missense Het probably damaging 0.997 phenotype 10/20/2017
24 490716 APN Hsd17b14 IGL03493 7 45556091 D42V A T unclassified Het possibly damaging 0.955 10/20/2017
25 490715 APN C2cd2 IGL03493 16 97881661 D289G T C missense Het probably damaging 0.968 10/20/2017
26 490714 APN Ibtk IGL03493 9 85718919 S797R G T missense Het probably benign 0.444 phenotype 10/20/2017
27 490713 APN Dzip3 IGL03493 16 48951696 I537V T C missense Het probably benign 0.322 phenotype 10/20/2017
28 490712 APN Aldoart1 IGL03493 4 72851647 T253I G A missense Het probably damaging 0.984 10/20/2017
29 490711 APN Olfr676 IGL03493 7 105035944 T249A A G missense Het probably damaging 0.999 10/20/2017
30 490710 APN Olfr1167 IGL03493 2 88149936 P28S G A missense Het probably benign 0.016 10/20/2017
31 490709 APN Ugt3a2 IGL03493 15 9361483 Y115C A G missense Het probably damaging 0.963 10/20/2017
32 490708 APN Zfp955b IGL03493 17 33302545 H329Q T G missense Het probably benign 0.199 10/20/2017
33 490707 APN Olfr60 IGL03493 7 140345153 Y279N A T missense Het probably damaging 1.000 10/20/2017
34 490541 UTSW Ppargc1b R5879 G1 207 N 18 61309093 D575H C G missense Het probably damaging 0.983 phenotype 10/20/2017
35 490540 UTSW Rgs11 R5879 G1 211 N 17 26203463 Q47* C T nonsense Het probably null phenotype 10/20/2017
36 490539 UTSW Rrp1b R5878 G1 225 N 17 32047675 E72G A G missense Het probably damaging 0.997 10/20/2017
37 490538 UTSW Parg R5878 G1 225 N 14 32217662 D548E T A missense Het probably benign 0.060 phenotype 10/20/2017
38 490537 UTSW Aggf1 R5878 G1 225 N 13 95369557 E174G T C missense Het probably benign 0.178 10/20/2017
39 490536 UTSW Nr3c2 R5878 G1 225 N 8 76908268 A G critical splice acceptor site Het probably null phenotype 10/20/2017
40 490535 UTSW Mctp2 R5878 G1 216 N 7 72214108 S336P A G missense Het probably benign 0.007 10/20/2017
41 490534 UTSW Otop1 R5878 G1 225 N 5 38277822 R129L G T missense Het possibly damaging 0.728 phenotype 10/20/2017
42 490533 UTSW Khk R5878 G1 225 N 5 30930875 T A critical splice donor site 2 bp Het probably null phenotype 10/20/2017
43 490532 UTSW Gapdhs R5877 G1 225 N 7 30732347 T280A T C missense Het probably damaging 0.998 phenotype 10/20/2017
44 490531 UTSW Ppargc1b R5876 G1 194 N 18 61309093 D575H C G missense Het probably damaging 0.983 phenotype 10/20/2017
45 490530 UTSW Asap2 R5876 G1 225 N 12 21212809 N229K T A missense Het possibly damaging 0.884 10/20/2017
46 490529 UTSW Vprbp R5876 G1 225 N 9 106863650 W1279R T C missense Het probably damaging 1.000 phenotype 10/20/2017
47 490528 UTSW Grid2 R5876 G1 225 N 6 64663162 I788N T A missense Het probably damaging 0.998 phenotype 10/20/2017
48 490527 UTSW Ubxn1 R5875 G1 225 N 19 8872220 S75P T C missense Het probably benign 0.000 10/20/2017
49 490526 UTSW Vmn2r101 R5875 G1 225 N 17 19588830 Y74N T A missense Het probably damaging 0.994 10/20/2017
50 490525 UTSW 4933417A18Rik R5875 G1 225 N 13 34932446 C59W T G missense Het probably damaging 0.994 10/20/2017
51 490524 UTSW Frmd5 R5875 G1 225 N 2 121558478 L27P A G missense Het noncoding transcript 10/20/2017
52 490523 UTSW Ctnna2 R5874 G1 225 N 6 76902430 T824A T C missense Het probably benign 0.003 phenotype 10/20/2017
53 490522 UTSW Sorcs2 R5874 G1 225 N 5 36229211 V161A A G missense Het probably damaging 0.995 10/20/2017
54 490521 UTSW Ppl R5873 G1 225 N 16 5106049 A G critical splice donor site Het unknown phenotype 10/20/2017
55 490520 UTSW Pdia4 R5873 G1 225 N 6 47808176 W86R A T missense Het probably damaging 1.000 10/20/2017
56 490519 UTSW Msh5 R5872 G1 225 N 17 35029652 C T critical splice donor site Het unknown phenotype 10/20/2017
57 490518 UTSW Sik1 R5872 G1 181 N 17 31850151 D250G T C missense Het probably damaging 1.000 10/20/2017
58 490517 UTSW Urb1 R5872 G1 174 N 16 90772764 W1358* C T nonsense Het probably null 10/20/2017
59 490516 UTSW Tnni3k R5871 G1 160 N 3 155030370 D112V T A missense Het probably benign 0.235 phenotype 10/20/2017
60 490515 UTSW Tc2n R5870 G1 138 N 12 101652852 V349D A T missense Het possibly damaging 0.938 10/20/2017
61 490514 UTSW Surf1 R5870 G1 166 N 2 26916259 T18K G T missense Het noncoding transcript phenotype 10/20/2017
62 490513 UTSW Nod1 R5859 G1 181 N 6 54930177 W902R A T missense Het probably benign 0.080 phenotype 10/20/2017
63 490512 UTSW Vars R5858 G1 214 N 17 35005475 R324C C T missense Het probably benign 0.304 10/20/2017
64 490511 UTSW Ephb2 R5858 G1 225 N 4 136672445 H588R T C missense Het probably benign 0.000 phenotype 10/20/2017
65 490510 UTSW Itpr3 R5856 G1 165 N 17 27106405 E1324G A G missense Het probably damaging 1.000 phenotype 10/20/2017
66 490509 UTSW Xpo6 R5856 G1 225 N 7 126149502 A T critical splice donor site Het unknown 10/20/2017
67 490508 UTSW Prkg1 R5855 G1 218 N 19 30894694 V219I C T missense Het possibly damaging 0.928 phenotype 10/20/2017
68 490507 UTSW Gmcl1 R5854 G1 225 N 6 86714259 Y250H A G missense Het noncoding transcript phenotype 10/20/2017
69 490506 UTSW Tbc1d13 R5853 G1 196 N 2 30137381 H100Q T A missense Het probably damaging 1.000 10/20/2017
70 490505 UTSW Rfk R5851 G1 225 N 19 17395198 A28V C T missense Het probably damaging 1.000 phenotype 10/20/2017
71 490504 UTSW Myo1e R5851 G1 225 N 9 70383804 G959E G A missense Het probably benign 0.173 phenotype 10/20/2017
72 490503 UTSW Drd3 R5850 G1 225 N 16 43818332 M267L A C missense Het probably benign 0.002 phenotype 10/20/2017
73 490502 UTSW Cnot1 R5850 G1 225 N 8 95734147 S1744L G A missense Het probably benign 0.004 10/20/2017
74 490501 UTSW Lrp4 R5883 G1 225 N 2 91488433 Y872H T C missense Het probably benign 0.006 phenotype 10/20/2017
75 490500 UTSW Tmc5 R5882 G1 172 N 7 118654919 N660S A G missense Het probably damaging 0.992 10/20/2017
76 490499 UTSW Lrrc69 R5882 G1 225 N 4 14708690 F218S A G missense Het probably damaging 0.999 10/20/2017
77 490498 UTSW Desi2 R5881 G1 225 N 1 178237913 Y15C A G missense Het probably damaging 0.999 phenotype 10/20/2017
78 490497 UTSW Acaa2 R5880 G1 225 N 18 74804001 V319M G A missense Het probably damaging 0.999 10/20/2017
79 490496 UTSW Peak1 R5880 G1 184 N 9 56207610 I1349N A T missense Het probably damaging 1.000 10/20/2017
80 490495 UTSW Dhodh R5880 G1 168 N 8 109594777 T326S T A missense Het probably benign 0.000 10/20/2017
81 490494 UTSW Sdk2 R5869 G1 225 N 11 113851882 Y734H A G missense Het probably damaging 0.962 10/20/2017
82 490493 UTSW Mmp12 R5869 G1 122 N 9 7348446 GTAATAATAATAATAATAAT GTAATAATAATAATAAT makesense Het unknown phenotype 10/20/2017
83 490492 UTSW Mroh3 R5869 G1 225 N 1 136186123 M487L T A missense Het probably benign 0.001 10/20/2017
84 490491 UTSW Npr1 R5868 G1 225 N 3 90459493 V48A A G missense Het not run phenotype 10/20/2017
85 490490 UTSW Alad R5867 G1 225 N 4 62512966 Y56N A T missense Het probably damaging 0.992 10/20/2017
86 490489 UTSW Mff R5867 G1 225 N 1 82750606 T C critical splice donor site 2 bp Het probably null 10/20/2017
87 490488 UTSW C8g R5864 G1 225 N 2 25498943 W123* C T nonsense Het probably null 10/20/2017
88 490487 UTSW Prl3c1 R5863 G1 225 N 13 27203610 *213K T A makesense Het probably null 10/20/2017
89 490486 UTSW Pik3ap1 R5862 G1 225 N 19 41332345 D145V T A missense Het probably damaging 1.000 phenotype 10/20/2017
90 490485 UTSW Ms4a6b R5862 G1 225 N 19 11521803 F94I T A missense Het probably benign 0.125 10/20/2017
91 490484 UTSW Golgb1 R5862 G1 225 N 16 36926091 H174L A T missense Het noncoding transcript 10/20/2017
92 490483 UTSW Ighv12-2 R5862 G1 225 N 12 114127937 A G critical splice donor site Het unknown 10/20/2017
93 490482 UTSW Tyms R5862 G1 225 N 5 30063410 D97E A T missense Het probably damaging 1.000 10/20/2017
94 490481 UTSW Il5 R5861 G1 225 N 11 53723916 E102K G A missense Het probably benign 0.020 phenotype 10/20/2017
95 490480 UTSW Myf5 R5861 G1 121 N 10 107484208 C194S A T missense Het probably benign 0.001 phenotype 10/20/2017
96 490479 UTSW Comtd1 R5849 G1 169 N 14 21848120 G110D C T missense Het probably damaging 1.000 10/20/2017
97 490478 UTSW Wfs1 R5849 G1 179 N 5 36973264 G213R C G missense Het probably damaging 1.000 phenotype 10/20/2017
98 490477 UTSW Sorcs3 R5848 G1 225 N 19 48788511 H994L A T missense Het probably damaging 0.998 phenotype 10/20/2017
99 490476 UTSW Espl1 R5848 G1 225 N 15 102322576 V1837I G A missense Het probably benign 0.026 phenotype 10/20/2017
100 490475 UTSW Fanca R5848 G1 225 N 8 123295053 P633T G T missense Het noncoding transcript phenotype 10/20/2017
[records 1 to 100 of 399610] next >> last >|