Incidental Mutations

415,585 incidental mutations are currently displayed, and affect 22,187 genes.
65,066 are Possibly Damaging.
153,103 are Probably Damaging.
143,724 are Probably Benign.
44,287 are Probably Null.
16,991 create premature stop codons.
11,745 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 415585] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 11 UTSW Adck1 0.212 0152 Y feeble 12 88431151 Q185L A T missense Het probably benign 0.034 0.186 11/03/2009
2 7 UTSW Fscn3 0.235 0152 Y feeble 6 28429967 A G unclassified Homo probably benign 10/27/2009
3 10 UTSW Per1 0.532 0152 Y feeble 11 69104022 T G splice site Het probably benign phenotype 11/11/2009
4 13 UTSW Pkhd1 0.228 0152 Y feeble 1 20522894 I1665S A C missense Het possibly damaging 0.463 0.164 phenotype 11/06/2009
5 9 UTSW Tnrc6a 0.695 0152 Y feeble 7 123180654 P1303T C A missense Het probably damaging 1.000 0.522 phenotype 11/12/2009
6 8 UTSW Usp47 0.462 0152 Y feeble 7 112056577 Y154H T C missense Het probably damaging 0.959 0.414 phenotype 11/02/2009
7 12 UTSW Zfp952 0.082 0152 Y feeble 17 33003221 T A unclassified 135 bp Het probably null 0.570 11/03/2009
8 150 UTSW Afmid 0.176 2107 Y triaka 11 117835561 N198K T A missense Homo probably damaging 1.000 0.027 phenotype 03/22/2010
9 148 UTSW Fam184a 0.274 2107 Y triaka 10 53641057 E374G T C missense Homo probably damaging 0.999 0.268 03/20/2010
10 149 UTSW Mypn 0.256 2107 Y triaka 10 63203751 C T utr 5 prime Homo probably benign 0.056 phenotype 03/22/2010
11 144 UTSW Nme7 0.451 2107 Y triaka 1 164345353 I211N T A missense Het possibly damaging 0.939 0.276 phenotype 03/19/2010
12 145 UTSW Tmod4 0.183 2107 Y triaka 3 95130168 G A unclassified Homo probably null 0.634 phenotype 03/19/2010
13 146 UTSW Wfs1 0.357 2107 Y triaka 5 36967273 R758H C T missense Het probably damaging 0.996 0.258 phenotype 03/19/2010
14 147 UTSW Zfp112 0.224 2107 Y triaka 7 24126841 C745R T C missense Het probably damaging 1.000 0.626 03/19/2010
15 68 UTSW Clca2 0.000 3370 Y dazzle 3 145077977 A626T C T missense Homo probably damaging 1.000 0.252 phenotype 12/08/2009
16 67 UTSW Dido1 0.878 3370 Y dazzle 2 180671542 M979T A G missense Homo probably benign 0.000 0.126 phenotype 12/08/2009
17 69 UTSW Mnx1 1.000 3370 Y dazzle 5 29474887 C241R A G missense Homo unknown 0.450 phenotype 12/08/2009
18 70 UTSW Rab38 0.151 3370 Y dazzle 7 88490651 H176R A G missense Homo probably benign 0.003 0.082 phenotype 12/08/2009
19 72 UTSW Tap2 0.101 3370 Y dazzle 17 34209279 A G unclassified 3911 bp Homo probably null 0.490 phenotype 12/08/2009
20 71 UTSW Tmem167 0.401 3370 Y dazzle 13 90098466 K36N A C missense Homo probably damaging 0.989 0.212 12/08/2009
21 135 UTSW Ankmy2 0.558 7510 G3 Y sublytic 12 36157412 V19A T C missense Het probably benign 0.057 0.134 03/12/2010
22 136 UTSW Camk4 0.341 7510 G3 Y sublytic 18 33156839 A180S G T missense Homo probably null 0.990 0.368 phenotype 03/12/2010
23 134 UTSW Slc28a1 0.208 7510 G3 Y sublytic 7 81169269 V622A T C missense Het probably benign 0.000 0.152 03/12/2010
24 23 UTSW Capn9 0.172 A2778 Y phoebus 8 124605478 F396S T C missense Homo possibly damaging 0.953 0.294 phenotype 11/09/2009
25 107 UTSW Asap1 0.269 A4554 Y gemini 15 64124711 T C splice site Het probably benign phenotype 03/16/2010
26 94 UTSW Bpifb5 0.090 A4554 Y gemini 2 154227180 Y139F A T missense Homo possibly damaging 0.707 0.058 03/16/2010
27 101 UTSW Chd2 0.618 A4554 Y gemini 7 73480968 V782G A C missense Homo probably benign 0.000 0.117 phenotype 03/16/2010
28 109 UTSW Chst4 0.047 A4554 Y gemini 8 110029888 Q448K G T missense Homo probably benign 0.085 0.082 phenotype 03/16/2010
29 110 UTSW Dido1 0.878 A4554 Y gemini 2 180675371 K8E T C missense Homo probably damaging 0.998 0.152 phenotype 03/16/2010
30 108 UTSW Evpl 0.000 A4554 Y gemini 11 116220834 L2010P A G missense Homo probably damaging 0.999 0.114 phenotype 03/16/2010
31 96 UTSW Fgl2 0.130 A4554 Y gemini 5 21372778 E21G A G missense Homo probably benign 0.007 0.128 phenotype 03/16/2010
32 103 UTSW Greb1l 0.579 A4554 Y gemini 18 10532862 M919L A T missense Homo possibly damaging 0.585 0.096 03/16/2010
33 99 UTSW Kel 0.099 A4554 Y gemini 6 41697419 D359V T A missense Homo possibly damaging 0.948 0.170 phenotype 03/16/2010
34 97 UTSW Lmtk2 0.251 A4554 Y gemini 5 144166317 D298G A G missense Homo possibly damaging 0.820 0.204 phenotype 03/16/2010
35 105 UTSW Masp1 0.181 A4554 Y gemini 16 23454940 A T splice site Homo probably null 0.631 phenotype 03/16/2010
36 100 UTSW Mrgprb8 0.030 A4554 Y gemini 7 48389408 I276F A T missense Homo probably damaging 0.999 0.290 03/16/2010
37 106 UTSW Nde1 0.843 A4554 Y gemini 16 14188410 T C splice site Homo probably benign phenotype 03/16/2010
38 93 UTSW Rbck1 0.000 A4554 Y gemini 2 152319172 N385K G T missense Homo probably damaging 0.999 0.028 phenotype 03/16/2010
39 132 UTSW Senp6 1.000 A4554 Y gemini 9 80148458 G T unclassified Het probably benign 0.060 phenotype 03/16/2010
40 95 UTSW Tm4sf4 0.112 A4554 Y gemini 3 57437767 T A critical splice donor site 2 bp Homo probably null 0.506 phenotype 03/16/2010
41 98 UTSW Ubn2 0.623 A4554 Y gemini 6 38484110 H488L A T missense Homo probably damaging 0.999 0.380 03/16/2010
42 104 UTSW Vmn2r120 0.167 A4554 Y gemini 17 57525715 F155L A G missense Homo probably benign 0.011 0.123 03/16/2010
43 102 UTSW Vmn2r65 0.118 A4554 Y gemini 7 84946583 T298S T A missense Homo probably damaging 0.958 0.030 03/16/2010
44 61 UTSW Kat14 1.000 A5278 Y 453 2 144393307 S18* C A nonsense Het probably null 0.566 phenotype 12/03/2009
45 63 UTSW Kif17 0.149 A5278 Y 453 4 138287950 V278A T C missense Homo probably benign 0.326 0.002 phenotype 12/03/2009
46 60 UTSW Myo3a 0.323 A5278 Y 453 2 22323653 T353A A G missense Het probably benign 0.269 0.056 phenotype 12/03/2009
47 66 UTSW Pbk 0.282 A5278 Y 453 14 65813939 I142N T A missense Het probably damaging 1.000 0.450 phenotype 12/03/2009
48 74 UTSW Rab32 0.073 A5278 Y 453 10 10557973 I39T A G missense Het possibly damaging 0.941 0.270 phenotype 01/05/2010
49 64 UTSW Rhou 0.078 A5278 Y 453 8 123660991 C154F G T missense Het probably damaging 0.991 phenotype 12/03/2009
50 65 UTSW Slc4a1 1.000 A5278 Y 453 11 102353815 A G splice site Het probably benign phenotype 12/03/2009
51 62 UTSW Tdrd7 0.606 A5278 Y 453 4 46007622 T558M C T missense Homo probably benign 0.007 0.150 phenotype 12/03/2009
52 19 UTSW Ablim1 0.414 A9681 G3 Y atchoum 19 57173323 A G critical splice donor site 2 bp Homo probably null 0.538 phenotype 11/06/2009
53 15 UTSW Akap2 0.215 A9681 G3 Y atchoum 4 57855358 Q270R A G missense Het probably damaging 0.999 0.396 phenotype 11/09/2009
54 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
55 16 UTSW Ints1 1.000 A9681 G3 Y atchoum 5 139770139 E538G T C missense Homo possibly damaging 0.564 0.220 phenotype 11/10/2009
56 17 UTSW Olfr664 0.162 A9681 G3 Y atchoum 7 104734403 T C Het 11/11/2009
57 14 UTSW Pld1 0.000 A9681 G3 Y atchoum 3 28085832 H600Q C A missense Homo probably benign 0.007 0.122 phenotype 11/11/2009
58 262514 UTSW 1110038F14Rik ANU05 225 N 15 76950275 V124I G A missense Het probably damaging 0.999 02/04/2015
59 262520 UTSW 1700019N19Rik 0.000 ANU05 225 N 19 58789113 H80Q A T missense Het probably damaging 1.000 02/04/2015
60 262502 UTSW Acaca 1.000 ANU05 225 N 11 84315852 K1513E A G missense Het probably damaging 0.999 phenotype 02/04/2015
61 262482 UTSW Acacb 0.000 ANU05 225 N 5 114225870 F1464Y T A missense Het probably benign 0.027 phenotype 02/04/2015
62 262497 UTSW Adgrg6 1.000 ANU05 225 N 10 14410530 A1114V G A missense Het possibly damaging 0.918 phenotype 02/04/2015
63 262475 UTSW Agl 0.265 ANU05 225 N 3 116772789 I975T A G missense Het possibly damaging 0.485 phenotype 02/04/2015
64 262498 UTSW Akap7 0.000 ANU05 225 N 10 25271553 H93R T C missense Het probably damaging 1.000 phenotype 02/04/2015
65 262474 UTSW Arhgef11 0.000 ANU05 225 N 3 87733174 W1213R T C missense Het probably benign 0.001 phenotype 02/04/2015
66 262499 UTSW Ccar1 0.901 ANU05 225 N 10 62756649 E708V T A missense Het probably damaging 0.996 02/04/2015
67 262477 UTSW Cfap206 0.319 ANU05 225 N 4 34721562 S162N C T missense Het probably damaging 1.000 02/04/2015
68 262494 UTSW Cilp 0.048 ANU05 225 N 9 65278983 S787P T C missense Het possibly damaging 0.803 phenotype 02/04/2015
69 262463 UTSW Col6a3 0.000 ANU05 225 N 1 90802292 T1157I G A missense Het probably damaging 0.998 phenotype 02/04/2015
70 262472 UTSW D630003M21Rik 0.103 ANU05 225 N 2 158196388 Y1046C T C missense Het probably benign 0.005 02/04/2015
71 262495 UTSW Dock3 0.498 ANU05 225 N 9 106895663 S464P A G missense Het probably benign 0.000 phenotype 02/04/2015
72 262470 UTSW Dusp19 0.193 ANU05 225 N 2 80624274 T113A A G missense Het probably benign 0.008 phenotype 02/04/2015
73 262507 UTSW Dync1h1 1.000 ANU05 225 N 12 110649104 Y2957S A C missense Het probably benign 0.311 phenotype 02/04/2015
74 262510 UTSW Epdr1 0.124 ANU05 225 N 13 19594644 Y94C T C missense Het probably damaging 0.999 phenotype 02/04/2015
75 262492 UTSW Fcho1 0.240 ANU05 225 N 8 71712547 L422Q A T missense Het probably benign 0.082 02/04/2015
76 262468 UTSW Gca 0.105 ANU05 225 N 2 62690443 Y210* T A nonsense Het probably null phenotype 02/04/2015
77 262485 UTSW Gpnmb 0.000 ANU05 225 N 6 49055681 V513A T C missense Het probably benign 0.117 phenotype 02/04/2015
78 262512 UTSW Irx4 0.611 ANU05 225 N 13 73267667 T192A A G missense Het probably damaging 0.998 phenotype 02/04/2015
79 262511 UTSW Isca1 0.849 ANU05 225 N 13 59758971 T54A T C missense Het probably benign 0.007 phenotype 02/04/2015
80 262478 UTSW Kif12 0.287 ANU05 106 N 4 63171423 GGGGC GGGGCCTCCACCCGGCGGGC small insertion Het probably benign phenotype 02/04/2015
81 262473 UTSW L3mbtl1 0.350 ANU05 216 N 2 162970180 V715A T C missense Het probably benign 0.301 phenotype 02/04/2015
82 262517 UTSW Lama1 1.000 ANU05 104 N 17 67738870 D257N G A missense Het probably damaging 0.996 phenotype 02/04/2015
83 262501 UTSW Lgr5 1.000 ANU05 225 N 10 115478534 H166R T C missense Het probably damaging 1.000 phenotype 02/04/2015
84 262486 UTSW M6pr 0.000 ANU05 225 N 6 122312259 R9G A G missense Het probably benign 0.077 phenotype 02/04/2015
85 262466 UTSW Nmt2 0.393 ANU05 225 N 2 3314694 S240R T G missense Het probably benign 0.000 phenotype 02/04/2015
86 262505 UTSW Npas3 0.774 ANU05 110 N 12 54068074 E593G A G missense Het possibly damaging 0.491 phenotype 02/04/2015
87 262471 UTSW Olfr1076 0.148 ANU05 225 N 2 86509169 A237T G A missense Het possibly damaging 0.907 phenotype 02/04/2015
88 262479 UTSW Pank4 0.255 ANU05 225 N 4 154974646 M412T T C missense Het probably damaging 0.979 phenotype 02/04/2015
89 262519 UTSW Psd 0.465 ANU05 192 N 19 46314747 V100A A G missense Het possibly damaging 0.766 phenotype 02/04/2015
90 262515 UTSW Rab11fip3 0.364 ANU05 225 N 17 26016113 T28A T C missense Het probably damaging 0.994 phenotype 02/04/2015
91 262464 UTSW Rnpepl1 0.245 ANU05 153 N 1 92919746 D685V A T missense Het probably benign 0.000 02/04/2015
92 262493 UTSW Rrad 0.497 ANU05 224 N 8 104630651 E88G T C missense Het probably benign 0.001 phenotype 02/04/2015
93 262503 UTSW Sdk2 0.141 ANU05 225 N 11 113843080 M846L T A missense Het probably benign 0.000 phenotype 02/04/2015
94 262481 UTSW Sparcl1 0.000 ANU05 225 N 5 104094715 V36E A T missense Het possibly damaging 0.879 phenotype 02/04/2015
95 262483 UTSW Srrm4 0.437 ANU05 225 N 5 116467569 E210K C T missense Het unknown phenotype 02/04/2015
96 262465 UTSW Stk25 0.000 ANU05 156 N 1 93623423 A T unclassified 2427 bp Het probably null phenotype 02/04/2015
97 262476 UTSW Tacr3 0.000 ANU05 225 N 3 134930049 Y338F A T missense Het probably damaging 1.000 phenotype 02/04/2015
98 262516 UTSW Tap2 0.101 ANU05 196 N 17 34209210 Q286L A T missense Het probably benign 0.010 phenotype 02/04/2015
99 262508 UTSW Tedc1 0.554 ANU05 225 N 12 113163188 R357* C T nonsense Het probably null 02/04/2015
100 262490 UTSW Tubgcp5 0.972 ANU05 225 N 7 55808529 A396E C A missense Het possibly damaging 0.829 02/04/2015
[records 1 to 100 of 415585] next >> last >|