Incidental Mutations

396,041 incidental mutations are currently displayed, and affect 23,686 genes.
58,758 are Possibly Damaging.
127,754 are Probably Damaging.
135,354 are Probably Benign.
36,959 are Probably Null.
17,293 create premature stop codons.
6,821 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 396041] next >> last >| per page Full List
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
MGI Phenotype question?
Posted question?
1 11 UTSW Adck1 0152 Y feeble 12 88431151 Q185L A T missense Het probably benign 0.034 11/03/2009
2 7 UTSW Fscn3 0152 Y feeble 6 28429967 A G splice acceptor site Homo probably benign 10/27/2009
3 10 UTSW Per1 0152 Y feeble 11 69104022 T G splice acceptor site Het probably benign phenotype 11/11/2009
4 13 UTSW Pkhd1 0152 Y feeble 1 20522894 I1665S A C missense Het possibly damaging 0.463 phenotype 11/06/2009
5 9 UTSW Tnrc6a 0152 Y feeble 7 123180654 P1303T C A missense Het probably damaging 1.000 phenotype 11/12/2009
6 8 UTSW Usp47 0152 Y feeble 7 112056577 Y154H T C missense Het probably damaging 0.991 phenotype 11/02/2009
7 12 UTSW Zfp952 0152 Y feeble 17 33003221 C225S T A missense Het possibly damaging 0.533 11/03/2009
8 150 UTSW Afmid 2107 Y triaka 11 117835561 N198K T A missense Homo probably damaging 1.000 03/22/2010
9 148 UTSW Fam184a 2107 Y triaka 10 53641057 E977G T C missense Homo probably damaging 0.976 03/20/2010
10 149 UTSW Mypn 2107 Y triaka 10 63203751 C T unclassified Homo possibly damaging 0.808 03/22/2010
11 144 UTSW Nme7 2107 Y triaka 1 164345353 I211N T A missense Het possibly damaging 0.939 phenotype 03/19/2010
12 145 UTSW Tmod4 2107 Y triaka 3 95130168 G A unclassified Homo probably null 03/19/2010
13 146 UTSW Wfs1 2107 Y triaka 5 36967273 R758H C T missense Het probably damaging 0.996 phenotype 03/19/2010
14 147 UTSW Zfp112 2107 Y triaka 7 24126841 C749R T C missense Het probably damaging 1.000 03/19/2010
15 68 UTSW Clca2 3370 Y dazzle 3 145077977 A626T C T missense Homo probably damaging 1.000 phenotype 12/08/2009
16 67 UTSW Dido1 3370 Y dazzle 2 180671542 M979T A G missense Homo probably benign 0.000 phenotype 12/08/2009
17 69 UTSW Mnx1 3370 Y dazzle 5 29474887 C241R A G missense Homo unknown phenotype 12/08/2009
18 70 UTSW Rab38 3370 Y dazzle 7 88490651 H176R A G missense Homo probably benign 0.003 phenotype 12/08/2009
19 72 UTSW Tap2 3370 Y dazzle 17 34209279 Y309C A G missense Homo probably damaging 1.000 phenotype 12/08/2009
20 71 UTSW Tmem167 3370 Y dazzle 13 90098466 K36N A C missense Homo possibly damaging 0.883 12/08/2009
21 135 UTSW Ankmy2 7510 G3 Y sublytic 12 36157412 V19A T C missense Het probably benign 0.057 03/12/2010
22 136 UTSW Camk4 7510 G3 Y sublytic 18 33156839 A180S G T missense Homo probably damaging 0.990 phenotype 03/12/2010
23 134 UTSW Slc28a1 7510 G3 Y sublytic 7 81169269 V622A T C missense Het probably benign 0.000 03/12/2010
24 23 UTSW Capn9 A2778 Y phoebus 8 124605478 F396S T C missense Homo possibly damaging 0.953 phenotype 11/09/2009
25 107 UTSW Asap1 A4554 Y Gemini 15 64124711 T C splice donor site 7 bp Het probably benign 03/16/2010
26 94 UTSW Bpifb5 A4554 Y Gemini 2 154227180 Y139F A T missense Homo possibly damaging 0.707 03/16/2010
27 101 UTSW Chd2 A4554 Y Gemini 7 73480968 V782G A C missense Homo probably benign 0.000 phenotype 03/16/2010
28 109 UTSW Chst4 A4554 Y Gemini 8 110029888 Q365K G T missense Homo probably benign 0.000 phenotype 03/16/2010
29 110 UTSW Dido1 A4554 Y Gemini 2 180675371 K548E T C missense Homo probably benign 0.259 phenotype 03/16/2010
30 108 UTSW Evpl A4554 Y Gemini 11 116220834 L2010P A G missense Homo probably damaging 0.999 phenotype 03/16/2010
31 96 UTSW Fgl2 A4554 Y Gemini 5 21372778 E21G A G missense Homo probably benign 0.007 phenotype 03/16/2010
32 103 UTSW Greb1l A4554 Y Gemini 18 10532862 M919L A T missense Homo possibly damaging 0.530 03/16/2010
33 99 UTSW Kel A4554 Y Gemini 6 41697419 D359V T A missense Homo possibly damaging 0.948 phenotype 03/16/2010
34 97 UTSW Lmtk2 A4554 Y Gemini 5 144166317 D298G A G missense Homo possibly damaging 0.820 phenotype 03/16/2010
35 105 UTSW Masp1 A4554 Y Gemini 16 23454940 A T splice acceptor site Homo probably benign phenotype 03/16/2010
36 100 UTSW Mrgprb8 A4554 Y Gemini 7 48389408 I276F A T missense Homo probably damaging 1.000 03/16/2010
37 106 UTSW Nde1 A4554 Y Gemini 16 14188410 T C splice donor site 6 bp Homo probably benign phenotype 03/16/2010
38 93 UTSW Rbck1 A4554 Y Gemini 2 152319172 N385K G T missense Homo probably damaging 1.000 phenotype 03/16/2010
39 132 UTSW Senp6 A4554 Y Gemini 9 80148458 G T unclassified Het unknown phenotype 03/16/2010
40 95 UTSW Tm4sf4 A4554 Y Gemini 3 57437767 T A critical splice donor site 2 bp Homo probably null 03/16/2010
41 98 UTSW Ubn2 A4554 Y Gemini 6 38484110 H658L A T missense Homo possibly damaging 0.650 03/16/2010
42 104 UTSW Vmn2r120 A4554 Y Gemini 17 57525715 F155L A G missense Homo probably benign 0.108 03/16/2010
43 102 UTSW Vmn2r65 A4554 Y Gemini 7 84946583 T298S T A missense Homo probably damaging 0.958 03/16/2010
44 61 UTSW Csrp2bp A5278 Y 453 2 144393307 S229* C A nonsense Het probably null phenotype 12/03/2009
45 63 UTSW Kif17 A5278 Y 453 4 138287950 V470A T C missense Homo probably benign 0.004 phenotype 12/03/2009
46 60 UTSW Myo3a A5278 Y 453 2 22323653 T353A A G missense Het probably benign 0.440 phenotype 12/03/2009
47 66 UTSW Pbk A5278 Y 453 14 65813939 I142N T A missense Het probably damaging 1.000 phenotype 12/03/2009
48 74 UTSW Rab32 A5278 Y 453 10 10557973 I39T A G missense Het possibly damaging 0.941 01/05/2010
49 64 UTSW Rhou A5278 Y 453 8 123660991 C154F G T missense Het probably damaging 0.999 12/03/2009
50 65 UTSW Slc4a1 A5278 Y 453 11 102353815 A G splice donor site 9 bp Het probably benign phenotype 12/03/2009
51 62 UTSW Tdrd7 A5278 Y 453 4 46007622 T558M C T missense Homo probably benign 0.004 phenotype 12/03/2009
52 19 UTSW Ablim1 A9681 G3 Y atchoum 19 57173323 A G critical splice donor site 2 bp Homo probably null phenotype 11/06/2009
53 15 UTSW Akap2 A9681 G3 Y atchoum 4 57855358 Q270R A G missense Het probably damaging 0.996 11/09/2009
54 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 L38* T A nonsense Het probably null 11/10/2009
55 16 UTSW Ints1 A9681 G3 Y atchoum 5 139770139 E538G T C missense Homo possibly damaging 0.947 phenotype 11/10/2009
56 17 UTSW Olfr664 A9681 G3 Y atchoum 7 104734403 T C splice acceptor site Het probably benign 11/11/2009
57 14 UTSW Pld1 A9681 G3 Y atchoum 3 28085832 H600Q C A missense Homo probably benign 0.002 phenotype 11/11/2009
58 262514 UTSW 1110038F14Rik ANU05 225 N 15 76950275 V186I G A missense Het probably damaging 0.999 02/04/2015
59 262477 UTSW 1700003M02Rik ANU05 225 N 4 34721562 S162N C T missense Het probably damaging 1.000 02/04/2015
60 262520 UTSW 1700019N19Rik ANU05 225 N 19 58789113 H88Q A T missense Het probably damaging 1.000 02/04/2015
61 262508 UTSW 4930427A07Rik ANU05 225 N 12 113163188 R357* C T nonsense Het probably null 02/04/2015
62 262502 UTSW Acaca ANU05 225 N 11 84315852 K1513E A G missense Het probably damaging 0.999 phenotype 02/04/2015
63 262482 UTSW Acacb ANU05 225 N 5 114225870 F1464Y T A missense Het probably benign 0.027 phenotype 02/04/2015
64 262497 UTSW Adgrg6 ANU05 225 N 10 14410530 A1086V G A missense Het probably benign 0.244 phenotype 02/04/2015
65 262475 UTSW Agl ANU05 225 N 3 116772789 I975T A G missense Het probably benign 0.039 02/04/2015
66 262498 UTSW Akap7 ANU05 225 N 10 25271553 H93R T C missense Het probably damaging 1.000 phenotype 02/04/2015
67 262474 UTSW Arhgef11 ANU05 225 N 3 87733174 W1242R T C missense Het probably benign 0.001 phenotype 02/04/2015
68 262513 UTSW C7 ANU05 225 N 15 4994258 A G splice acceptor site Het probably benign 02/04/2015
69 262499 UTSW Ccar1 ANU05 225 N 10 62756649 E708V T A missense Het probably damaging 0.996 02/04/2015
70 262494 UTSW Cilp ANU05 225 N 9 65278983 S787P T C missense Het possibly damaging 0.875 02/04/2015
71 262467 UTSW Col5a1 ANU05 225 N 2 27971444 T A splice acceptor site Het probably benign phenotype 02/04/2015
72 262463 UTSW Col6a3 ANU05 225 N 1 90802292 T1157I G A missense Het probably damaging 0.998 phenotype 02/04/2015
73 262472 UTSW D630003M21Rik ANU05 225 N 2 158196388 Y1046C T C missense Het probably benign 0.003 02/04/2015
74 262491 UTSW Dmbt1 ANU05 225 N 7 131032159 T A splice donor site 14 bp Het probably benign phenotype 02/04/2015
75 262495 UTSW Dock3 ANU05 225 N 9 106895663 S1942P A G missense Het probably benign 0.000 phenotype 02/04/2015
76 262496 UTSW Dock3 ANU05 225 N 9 106958400 T C splice donor site 7 bp Het probably benign phenotype 02/04/2015
77 262470 UTSW Dusp19 ANU05 225 N 2 80624274 T113A A G missense Het probably benign 0.008 02/04/2015
78 262507 UTSW Dync1h1 ANU05 225 N 12 110649104 Y2957S A C missense Het probably benign 0.311 phenotype 02/04/2015
79 262510 UTSW Epdr1 ANU05 225 N 13 19594644 Y94C T C missense Het probably damaging 0.999 02/04/2015
80 262492 UTSW Fcho1 ANU05 225 N 8 71712547 L422Q A T missense Het probably benign 0.082 02/04/2015
81 262468 UTSW Gca ANU05 225 N 2 62690443 Y210* T A nonsense Het probably null phenotype 02/04/2015
82 262500 UTSW Glipr1l2 ANU05 225 N 10 112092414 T A splice acceptor site Het probably benign 02/04/2015
83 262488 UTSW Gm5155 ANU05 225 N 7 17905116 I346K T A missense Het probably damaging 0.981 02/04/2015
84 262485 UTSW Gpnmb ANU05 225 N 6 49055681 V513A T C missense Het probably benign 0.117 phenotype 02/04/2015
85 262512 UTSW Irx4 ANU05 225 N 13 73267667 T192A A G missense Het probably damaging 0.998 phenotype 02/04/2015
86 262511 UTSW Isca1 ANU05 225 N 13 59758971 T54A T C missense Het probably benign 0.007 02/04/2015
87 262478 UTSW Kif12 ANU05 106 N 4 63171423 GGGGC GGGGCCTCCACCCGGCGGGC small insertion Homo unknown 02/04/2015
88 262473 UTSW L3mbtl1 ANU05 216 N 2 162970180 V715A T C missense Het probably benign 0.301 phenotype 02/04/2015
89 262517 UTSW Lama1 ANU05 104 N 17 67738870 D257N G A missense Het probably damaging 1.000 phenotype 02/04/2015
90 262501 UTSW Lgr5 ANU05 225 N 10 115478534 H166R T C missense Het probably damaging 1.000 phenotype 02/04/2015
91 262486 UTSW M6pr ANU05 225 N 6 122312259 R9G A G missense Het probably benign 0.077 phenotype 02/04/2015
92 262466 UTSW Nmt2 ANU05 225 N 2 3314694 S271R T G missense Het probably benign 0.000 phenotype 02/04/2015
93 262505 UTSW Npas3 ANU05 110 N 12 54068074 E593G A G missense Het possibly damaging 0.491 phenotype 02/04/2015
94 262471 UTSW Olfr1076 ANU05 225 N 2 86509169 A237T G A missense Het possibly damaging 0.907 02/04/2015
95 262479 UTSW Pank4 ANU05 225 N 4 154974646 M412T T C missense Het probably damaging 0.979 02/04/2015
96 262484 UTSW Ppp1r9a ANU05 225 N 6 5057446 T C splice acceptor site Het probably benign phenotype 02/04/2015
97 262519 UTSW Psd ANU05 192 N 19 46314747 V732A A G missense Het probably benign 0.075 02/04/2015
98 262480 UTSW Pus7 ANU05 225 N 5 23760310 A T splice acceptor site Het probably benign 02/04/2015
99 262515 UTSW Rab11fip3 ANU05 225 N 17 26016113 T609A T C missense Het probably benign 0.257 02/04/2015
100 262464 UTSW Rnpepl1 ANU05 153 N 1 92919746 D685V A T missense Het probably benign 0.000 02/04/2015
[records 1 to 100 of 396041] next >> last >|