Incidental Mutations

4,916 incidental mutations are currently displayed, and affect 3,602 genes.
0 are Possibly Damaging.
1 are Probably Damaging.
1 are Probably Benign.
4,857 are Probably Null.
0 create premature stop codons.
4,916 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 4916] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 46973 UTSW 0610009O20Rik R0511 G1 225 Y 18 38254071 T C critical splice donor site 2 bp Het probably null 06/11/2013
2 89459 APN 0610010F05Rik IGL01522 G1 11 23582865 A G critical splice donor site 2 bp Het probably null 12/03/2013
3 5766 APN 0610011F06Rik IGL00392 G1 17 25876124 T C critical splice donor site 2 bp Het probably null 04/20/2012
4 227312 UTSW 1110017D15Rik R2073 G1 225 N 4 41507519 A G critical splice donor site 2 bp Het probably null 09/17/2014
5 48619 UTSW 1110037F02Rik R0522 G1 214 Y 4 11519416 T C critical splice donor site 2 bp Het probably null 06/12/2013
6 266808 UTSW 1500009L16Rik R3416 G1 225 Y 10 83759632 T C critical splice donor site 2 bp Het probably null 02/18/2015
7 51166 APN 1700007G11Rik IGL01133 G1 5 98498381 T C critical splice donor site 2 bp Het probably null 06/21/2013
8 29378 APN 1700010I14Rik IGL00988 G1 17 8997105 T C critical splice donor site 2 bp Het probably null 04/17/2013
9 42078 UTSW 1700010I14Rik R0482 G1 225 Y 17 8988423 T C critical splice donor site 2 bp Het probably null 05/23/2013
10 265174 UTSW 1700015F17Rik R3056 G1 225 N 5 5457283 A T critical splice donor site 2 bp Het probably null 02/05/2015
11 311460 UTSW 1700021F07Rik R4006 G1 225 N 2 173526087 T C critical splice donor site Het probably null 04/29/2015
12 8421 APN 1700021K19Rik IGL00654 G1 16 32824377 A T critical splice donor site 2 bp Het probably null 12/06/2012
13 367277 UTSW 1700021K19Rik R4788 G1 107 N 16 32836408 A G critical splice donor site Het probably null 12/29/2015
14 231555 UTSW 1700021P04Rik R2087 G1 147 Y 19 24065000 T A critical splice donor site 2 bp Het probably null 09/18/2014
15 104905 APN 1700030K09Rik IGL01714 G1 8 72455569 T C critical splice donor site 2 bp Het probably null 01/21/2014
16 30540 UTSW 1700049G17Rik R0372 G1 211 Y 7 27920695 A T critical splice donor site 2 bp Het probably null 04/24/2013
17 151721 UTSW 1700074P13Rik R1250 G1 225 N 6 40925975 A T critical splice donor site 2 bp Het probably null 01/29/2014
18 234841 UTSW 1810065E05Rik R2156 G1 225 N 11 58422308 T A critical splice donor site 2 bp Het probably null 10/01/2014
19 105226 APN 2200002D01Rik IGL01724 G1 7 29247896 C T critical splice donor site 1 bp Het probably null 01/21/2014
20 76691 UTSW 2310003H01Rik R0782 G1 218 Y 11 120376704 A G critical splice donor site 2 bp Het probably null 10/16/2013
21 203614 UTSW 2310011J03Rik R1808 G1 225 N 10 80320181 A G critical splice donor site 2 bp Het probably null 06/23/2014
22 472880 UTSW 2310057J18Rik R4801 G1 225 N 10 28983926 A G critical splice donor site Het probably null 04/14/2017
23 370313 UTSW 2310057J18Rik R4802 G1 225 Y 10 28983926 A G critical splice donor site Het probably null 02/04/2016
24 174282 UTSW 2310067B10Rik R1616 G1 208 N 11 115796145 T C critical splice donor site 2 bp Het probably null 04/24/2014
25 38454 UTSW 2610020H08Rik R0347 G1 225 Y 7 119823896 T A critical splice donor site 2 bp Het probably null 05/23/2013
26 201065 UTSW 2610020H08Rik R1465 G1 215 N 7 119801358 T A critical splice donor site 2 bp Het probably null 05/23/2014
27 272395 UTSW 2610507B11Rik R3788 G1 225 Y 11 78288297 T A critical splice donor site Het probably null 03/25/2015
28 52457 APN 2700049A03Rik IGL01107 G1 12 71194468 T C critical splice donor site 2 bp Het probably null phenotype 06/21/2013
29 33807 UTSW 2700049A03Rik R0220 G1 140 N 12 71148420 T C critical splice donor site 2 bp Het probably null phenotype 05/09/2013
30 248884 UTSW 4732456N10Rik R2404 G1 225 Y 15 101554670 A G critical splice donor site 2 bp Het probably null 11/11/2014
31 191306 UTSW 4732465J04Rik R1719 G1 167 N 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Homo probably null 05/14/2014
32 247355 UTSW 4732465J04Rik R2312 G1 126 N 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Homo probably null 11/11/2014
33 260972 UTSW 4732465J04Rik R2884 G1 115 N 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Homo probably null 01/23/2015
34 30157 UTSW 4832428D23Rik R0363 G1 184 Y 1 44211030 A G critical splice donor site 2 bp Het probably null 04/24/2013
35 40057 UTSW 4833403I15Rik R0456 G1 225 N 18 46864816 G A critical splice donor site 1 bp Het probably null 05/23/2013
36 89778 APN 4833420G17Rik IGL01531 G1 13 119466958 T A critical splice donor site 2 bp Het probably null 12/03/2013
37 249919 UTSW 4833427G06Rik R2444 G1 225 N 9 51099998 A G critical splice donor site 2 bp Het probably null 11/12/2014
38 153057 APN 4833439L19Rik IGL01747 G1 13 54556525 A G critical splice donor site 2 bp Het probably null 02/04/2014
39 161756 UTSW 4921504E06Rik R1456 G1 225 Y 2 19480920 C T critical splice donor site 1 bp Het probably null 03/14/2014
40 204728 UTSW 4921506M07Rik R1819 G1 225 Y 12 57694500 T C critical splice donor site 2 bp Het probably null 06/23/2014
41 210875 UTSW 4921506M07Rik R1872 G1 225 Y 12 57704552 T C critical splice donor site 2 bp Het probably null 06/30/2014
42 274885 UTSW 4921524L21Rik R3820 G1 225 Y 18 6630166 G T critical splice donor site Het probably null 04/02/2015
43 158342 UTSW 4921528O07Rik R1301 G1 225 Y 1 163043983 C T critical splice donor site 1 bp Het probably null 02/18/2014
44 50633 APN 4930402H24Rik IGL01146 G1 2 130770671 C T critical splice donor site 1 bp Het probably null 06/21/2013
45 163374 UTSW 4930402H24Rik R1485 G1 211 N 2 130748683 A G critical splice donor site 2 bp Het probably null 03/28/2014
46 57037 UTSW 4930430A15Rik R0645 G1 159 Y 2 111214583 C T critical splice donor site 1 bp Het probably null 07/11/2013
47 200914 UTSW 4930430A15Rik R1464 G1 225 N 2 111225403 A G critical splice donor site 2 bp Het probably null 05/23/2014
48 180422 APN 4930433N12Rik IGL01930 G1 9 3134875 C T critical splice donor site 1 bp Het probably null 05/07/2014
49 251724 UTSW 4930510E17Rik R2847 G1 225 N 9 53264789 T C critical splice donor site 2 bp Het probably null 12/04/2014
50 162048 UTSW 4930522H14Rik R1460 G1 225 Y 4 109531210 A T critical splice donor site 2 bp Het probably null 03/14/2014
51 66370 UTSW 4930527J03Rik R0294 G1 111 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 08/19/2013
52 66437 UTSW 4930527J03Rik R0323 G1 105 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 08/19/2013
53 66460 UTSW 4930527J03Rik R0392 G1 107 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 08/19/2013
54 95821 UTSW 4930527J03Rik R1013 G1 109 Y 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 01/05/2014
55 152164 UTSW 4930527J03Rik R1247 G1 196 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 01/29/2014
56 203200 UTSW 4930538K18Rik R1802 G1 225 N 4 119210873 A T critical splice donor site 2 bp Het probably null 06/23/2014
57 204369 UTSW 4930562C15Rik R1775 G1 225 Y 16 4851558 G A critical splice donor site 1 bp Het probably null 06/23/2014
58 234249 UTSW 4930579F01Rik R2151 G1 225 Y 3 138176456 A G critical splice donor site 2 bp Het probably null 10/01/2014
59 54554 UTSW 4930596D02Rik R0609 G1 225 N 14 35811461 A T critical splice donor site 2 bp Het probably null 07/11/2013
60 267531 UTSW 4931409K22Rik R3522 G1 225 Y 5 24549626 A G critical splice donor site 2 bp Het probably null 02/18/2015
61 307848 UTSW 4932414N04Rik R3950 G1 225 N 2 68664403 T C critical splice donor site Het probably null 04/17/2015
62 307917 UTSW 4932414N04Rik R3951 G1 225 Y 2 68664403 T C critical splice donor site Het probably null 04/17/2015
63 307973 UTSW 4932414N04Rik R3952 G1 225 Y 2 68664403 T C critical splice donor site Het probably null 04/17/2015
64 78785 APN 4932438A13Rik IGL01377 G1 3 36973452 T C critical splice donor site 2 bp Het probably null 11/05/2013
65 222613 UTSW 4932438A13Rik R1987 G1 225 N 3 36953985 T A critical splice donor site 2 bp Het probably null 08/25/2014
66 241406 UTSW 4932438A13Rik R2220 G1 225 N 3 36875530 T C critical splice donor site 2 bp Het probably null 10/15/2014
67 234431 UTSW 4932441B19Rik R2152 G1 225 N 13 65033965 G A critical splice donor site 1 bp Het probably null 10/01/2014
68 249900 UTSW 4933406J08Rik R2444 G1 225 N 2 122193307 T A critical splice donor site 2 bp Het probably null 11/12/2014
69 214371 UTSW 4933424B01Rik R1906 G1 225 N 6 146552370 A T critical splice donor site 2 bp Het probably null 07/14/2014
70 40220 UTSW 4933427G23Rik R0415 G1 215 N 5 23831050 A T critical splice donor site 2 bp Het probably null 05/23/2013
71 267317 UTSW 5430419D17Rik R3439 G1 225 Y 7 131188779 T C critical splice donor site 2 bp Het probably null 02/18/2015
72 202011 UTSW 5430435G22Rik R1794 G1 212 N 1 131697068 T C critical splice donor site 2 bp Het probably null 06/23/2014
73 370013 UTSW 5730522E02Rik R4818 G1 225 Y 11 25770472 A G critical splice donor site Het probably null 02/04/2016
74 105156 APN 5830415F09Rik IGL01722 G1 4 46386092 A G critical splice donor site 2 bp Het probably null 01/21/2014
75 267631 UTSW 6330416G13Rik R3196 G1 225 N 4 63577912 G A critical splice donor site 1 bp Het probably null 02/18/2015
76 307722 UTSW 9030617O03Rik R3946 G1 159 Y 12 100838700 T C critical splice donor site Het probably null 04/17/2015
77 1445 APN 9030624J02Rik IGL00159 G1 7 118797047 G A critical splice donor site 1 bp Het probably null 07/12/2011
78 8495 APN 9130011E15Rik IGL00788 G1 19 45932350 C T critical splice donor site 1 bp Het probably null 0.000 12/06/2012
79 163571 UTSW 9130011E15Rik R1487 G1 225 N 19 45940443 A C critical splice donor site 2 bp Het probably null 03/28/2014
80 243965 UTSW 9130011E15Rik R2263 G1 225 Y 19 45932349 A G critical splice donor site 2 bp Het probably null 10/16/2014
81 177594 UTSW 9130401M01Rik R1587 G1 152 N 15 58028612 A G critical splice donor site 2 bp Het probably null 04/24/2014
82 42617 UTSW 9330182L06Rik R0494 G1 225 Y 5 9420723 G A critical splice donor site 1 bp Het probably null 05/23/2013
83 100452 UTSW 9430015G10Rik R1162 G1 225 Y 4 156122418 T C critical splice donor site 2 bp Het probably null 01/15/2014
84 174588 UTSW 9430016H08Rik R1620 G1 225 Y 1 57409985 T C critical splice donor site 2 bp Het probably null 04/24/2014
85 29822 UTSW 9630033F20Rik R0356 G1 225 Y 6 127091182 A G critical splice donor site 2 bp Het probably null phenotype 04/24/2013
86 101243 UTSW A1bg R1199 G1 225 Y 15 60919635 A T critical splice donor site 2 bp Het probably null 01/15/2014
87 311548 UTSW A1cf R4007 G1 225 Y 19 31918124 T C critical splice donor site Het probably null phenotype 04/29/2015
88 73767 APN A2m IGL01313 G1 6 121645010 T C critical splice donor site 2 bp Het probably null phenotype 10/07/2013
89 258011 UTSW A2m R0147 G1 63 Y 6 121662446 T C critical splice donor site 2 bp Het probably null phenotype 01/14/2015
90 60875 UTSW A2m R0148 G1 216 N 6 121662446 T C critical splice donor site 2 bp Het probably null phenotype 07/24/2013
91 370978 UTSW A3galt2 R4810 G1 182 Y 4 128755563 T C critical splice donor site Het probably null phenotype 02/04/2016
92 105513 APN A430093F15Rik IGL01731 G1 19 10785347 T A critical splice donor site 2 bp Het probably null 01/21/2014
93 244035 UTSW A830018L16Rik R2265 G1 225 N 1 11972104 T C critical splice donor site 2 bp Het probably null 10/16/2014
94 36850 UTSW A930018P22Rik R0418 G1 214 Y 2 104123330 G T critical splice donor site 1 bp Het probably null 05/09/2013
95 192871 UTSW AA986860 R1762 G1 225 N 1 130737688 G A critical splice donor site 1 bp Het probably null 05/23/2014
96 198064 UTSW Aacs R1725 G1 225 N 5 125482935 T C critical splice donor site 2 bp Het probably null 05/23/2014
97 217066 UTSW Aadac R1964 G1 225 N 3 60037338 T A critical splice donor site 2 bp Het probably null 08/01/2014
98 376782 UTSW Aadat R4874 G1 225 Y 8 60516113 G A critical splice donor site Het probably null phenotype 03/17/2016
99 211349 UTSW Aars2 R1878 G1 163 N 17 45514638 G A critical splice donor site 1 bp Het probably null 06/30/2014
100 88099 APN Aass IGL01465 G1 6 23114839 A G critical splice donor site 2 bp Het probably null 11/18/2013
[records 1 to 100 of 4916] next >> last >|