Incidental Mutations

5,541 incidental mutations are currently displayed, and affect 3,965 genes.
0 are Possibly Damaging.
1 are Probably Damaging.
1 are Probably Benign.
5,435 are Probably Null.
0 create premature stop codons.
5,541 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 5541] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 46973 UTSW 0610009O20Rik R0511 G1 225 Y 18 38254071 T C critical splice donor site 2 bp Het probably null 06/11/2013
2 89459 APN 0610010F05Rik IGL01522 G1 11 23582865 A G critical splice donor site 2 bp Het probably null 12/03/2013
3 396740 UTSW 0610010F05Rik R5156 G1 225 Y 11 23593424 A G critical splice donor site 2 bp Het probably null 06/21/2016
4 5766 APN 0610011F06Rik IGL00392 G1 17 25876124 T C critical splice donor site 2 bp Het probably null 04/20/2012
5 227312 UTSW 1110017D15Rik R2073 G1 225 N 4 41507519 A G critical splice donor site 2 bp Het probably null 09/17/2014
6 48619 UTSW 1110037F02Rik R0522 G1 214 Y 4 11519416 T C critical splice donor site 2 bp Het probably null 06/12/2013
7 266808 UTSW 1500009L16Rik R3416 G1 225 Y 10 83759632 T C critical splice donor site 2 bp Het probably null 02/18/2015
8 51166 APN 1700007G11Rik IGL01133 G1 5 98498381 T C critical splice donor site 2 bp Het probably null 06/21/2013
9 384609 UTSW 1700008F21Rik R4978 G1 225 Y 8 129110207 T C critical splice donor site 2 bp Het probably null 05/10/2016
10 29378 APN 1700010I14Rik IGL00988 G1 17 8997105 T C critical splice donor site 2 bp Het probably null 04/17/2013
11 42078 UTSW 1700010I14Rik R0482 G1 225 Y 17 8988423 T C critical splice donor site 2 bp Het probably null 05/23/2013
12 265174 UTSW 1700015F17Rik R3056 G1 225 N 5 5457283 A T critical splice donor site 2 bp Het probably null 02/05/2015
13 311460 UTSW 1700021F07Rik R4006 G1 225 N 2 173526087 T C critical splice donor site 2 bp Het probably null 04/29/2015
14 8421 APN 1700021K19Rik IGL00654 G1 16 32824377 A T critical splice donor site 2 bp Het probably null 12/06/2012
15 367277 UTSW 1700021K19Rik R4788 G1 107 N 16 32836408 A G critical splice donor site 2 bp Het probably null 12/29/2015
16 231555 UTSW 1700021P04Rik R2087 G1 147 Y 19 24065000 T A critical splice donor site 2 bp Het probably null 09/18/2014
17 104905 APN 1700030K09Rik IGL01714 G1 8 72455569 T C critical splice donor site 2 bp Het probably null 01/21/2014
18 432519 UTSW 1700039E15Rik R5485 G1 225 Y 7 45282542 G A critical splice donor site 1 bp Het probably null 10/05/2016
19 30540 UTSW 1700049G17Rik R0372 G1 211 Y 7 27920695 *96R A T critical splice donor site Het probably null 04/24/2013
20 151721 UTSW 1700074P13Rik R1250 G1 225 N 6 40925975 A T critical splice donor site 2 bp Het probably null 01/29/2014
21 480155 UTSW 1810062G17Rik R6028 G1 225.01 N 3 36479569 T A critical splice donor site 2 bp Het probably null 06/26/2017
22 234841 UTSW 1810065E05Rik R2156 G1 225 N 11 58422308 T A critical splice donor site 2 bp Het probably null 10/01/2014
23 105226 APN 2200002D01Rik IGL01724 G1 7 29247896 C T critical splice donor site 1 bp Het probably null 01/21/2014
24 76691 UTSW 2310003H01Rik R0782 G1 218 Y 11 120376704 A G critical splice donor site 2 bp Het probably null 10/16/2013
25 203614 UTSW 2310011J03Rik R1808 G1 225 N 10 80320181 A G critical splice donor site 2 bp Het probably null 06/23/2014
26 472880 UTSW 2310057J18Rik R4801 G1 225 N 10 28983926 A G critical splice donor site 2 bp Het probably null 04/14/2017
27 370313 UTSW 2310057J18Rik R4802 G1 225 Y 10 28983926 A G critical splice donor site 2 bp Het probably null 02/04/2016
28 174282 UTSW 2310067B10Rik R1616 G1 208 N 11 115796145 T C critical splice donor site 2 bp Het probably null 04/24/2014
29 38454 UTSW 2610020H08Rik R0347 G1 225 Y 7 119823896 T A critical splice donor site 2 bp Het probably null 05/23/2013
30 201065 UTSW 2610020H08Rik R1465 G1 215 N 7 119801358 T A critical splice donor site 2 bp Het probably null 05/23/2014
31 383621 UTSW 2610318N02Rik R4948 G1 127 Y 16 17118290 A T critical splice donor site 2 bp Het probably null 04/27/2016
32 272395 UTSW 2610507B11Rik R3788 G1 225 Y 11 78288297 T A critical splice donor site 2 bp Het probably null 03/25/2015
33 52457 APN 2700049A03Rik IGL01107 G1 12 71194468 T C critical splice donor site 2 bp Het probably null phenotype 06/21/2013
34 33807 UTSW 2700049A03Rik R0220 G1 140 N 12 71148420 T C critical splice donor site 2 bp Het probably null phenotype 05/09/2013
35 248884 UTSW 4732456N10Rik R2404 G1 225 Y 15 101554670 A G critical splice donor site 2 bp Het probably null 11/11/2014
36 191306 UTSW 4732465J04Rik R1719 G1 167 N 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Homo probably null 05/14/2014
37 247355 UTSW 4732465J04Rik R2312 G1 126 N 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Homo probably null 11/11/2014
38 30157 UTSW 4832428D23Rik R0363 G1 184 Y 1 44211030 A G critical splice donor site 2 bp Het probably null 04/24/2013
39 40057 UTSW 4833403I15Rik R0456 G1 225 N 18 46864816 G A critical splice donor site 1 bp Het probably null 05/23/2013
40 89778 APN 4833420G17Rik IGL01531 G1 13 119466958 T A critical splice donor site 2 bp Het probably null 12/03/2013
41 249919 UTSW 4833427G06Rik R2444 G1 225 N 9 51099998 A G critical splice donor site 2 bp Het probably null 11/12/2014
42 153057 APN 4833439L19Rik IGL01747 G1 13 54556525 A G critical splice donor site 2 bp Het probably null 02/04/2014
43 161756 UTSW 4921504E06Rik R1456 G1 225 Y 2 19480920 C T critical splice donor site 1 bp Het probably null 03/14/2014
44 274885 UTSW 4921524L21Rik R3820 G1 225 Y 18 6630166 G T critical splice donor site 1 bp Het probably null 04/02/2015
45 158342 UTSW 4921528O07Rik R1301 G1 225 Y 1 163043983 C T critical splice donor site 1 bp Het probably null 02/18/2014
46 50633 APN 4930402H24Rik IGL01146 G1 2 130770671 C T critical splice donor site 1 bp Het probably null 06/21/2013
47 163374 UTSW 4930402H24Rik R1485 G1 211 N 2 130748683 A G critical splice donor site 2 bp Het probably null 03/28/2014
48 57037 UTSW 4930430A15Rik R0645 G1 159 Y 2 111214583 C T critical splice donor site 1 bp Het probably null 07/11/2013
49 200914 UTSW 4930430A15Rik R1464 G1 225 N 2 111225403 A G critical splice donor site 2 bp Het probably null 05/23/2014
50 180422 APN 4930433N12Rik IGL01930 G1 9 3134875 C T critical splice donor site 1 bp Het probably null 05/07/2014
51 389692 UTSW 4930444P10Rik R4999 G1 225 N 1 16068798 A G critical splice donor site 2 bp Het probably null 06/06/2016
52 251724 UTSW 4930510E17Rik R2847 G1 225 N 9 53264789 T C critical splice donor site Het probably null 12/04/2014
53 162048 UTSW 4930522H14Rik R1460 G1 225 Y 4 109531210 A T critical splice donor site 2 bp Het probably null 03/14/2014
54 382049 UTSW 4930522L14Rik R4952 G1 225 Y 5 109739197 A G critical splice donor site 2 bp Het probably null 04/27/2016
55 396515 UTSW 4930522L14Rik R5143 G1 212 N 5 109739198 C T critical splice donor site 1 bp Het probably null 06/21/2016
56 66370 UTSW 4930527J03Rik R0294 G1 111 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 08/19/2013
57 66437 UTSW 4930527J03Rik R0323 G1 105 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 08/19/2013
58 66460 UTSW 4930527J03Rik R0392 G1 107 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 08/19/2013
59 95821 UTSW 4930527J03Rik R1013 G1 109 Y 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 01/05/2014
60 152164 UTSW 4930527J03Rik R1247 G1 196 N 1 178276503 ACCC ACC critical splice donor site 2 bp Homo probably null 01/29/2014
61 203200 UTSW 4930538K18Rik R1802 G1 225 N 4 119210873 A T critical splice donor site 2 bp Het probably null 06/23/2014
62 204369 UTSW 4930562C15Rik R1775 G1 225 Y 16 4851558 G A critical splice donor site 1 bp Het probably null 06/23/2014
63 234249 UTSW 4930579F01Rik R2151 G1 225 Y 3 138176456 A G critical splice donor site 2 bp Het probably null 10/01/2014
64 54554 UTSW 4930596D02Rik R0609 G1 225 N 14 35811461 A T critical splice donor site 2 bp Het probably null 07/11/2013
65 267531 UTSW 4931409K22Rik R3522 G1 225 Y 5 24549626 A G critical splice donor site 2 bp Het probably null 02/18/2015
66 439685 UTSW 4931423N10Rik R5619 G1 225 Y 2 23257005 T C critical splice donor site 2 bp Het probably null 11/08/2016
67 396289 UTSW 4931429L15Rik R5138 G1 225 Y 9 46306821 C A critical splice donor site 1 bp Het probably null 06/21/2016
68 307848 UTSW 4932414N04Rik R3950 G1 225 N 2 68664403 T C critical splice donor site 2 bp Het probably null 04/17/2015
69 307917 UTSW 4932414N04Rik R3951 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 04/17/2015
70 307973 UTSW 4932414N04Rik R3952 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 04/17/2015
71 78785 APN 4932438A13Rik IGL01377 G1 3 36973452 T C critical splice donor site 2 bp Het probably null 11/05/2013
72 222613 UTSW 4932438A13Rik R1987 G1 225 N 3 36953985 T A critical splice donor site 2 bp Het probably null 08/25/2014
73 241406 UTSW 4932438A13Rik R2220 G1 225 N 3 36875530 T C critical splice donor site 2 bp Het probably null 10/15/2014
74 234431 UTSW 4932441B19Rik R2152 G1 225 N 13 65033965 G A critical splice donor site 1 bp Het probably null 10/01/2014
75 249900 UTSW 4933406J08Rik R2444 G1 225 N 2 122193307 T A critical splice donor site 2 bp Het probably null 11/12/2014
76 214371 UTSW 4933424B01Rik R1906 G1 225 N 6 146552370 A T critical splice donor site 2 bp Het probably null 07/14/2014
77 40220 UTSW 4933427G23Rik R0415 G1 215 N 5 23831050 A T critical splice donor site 2 bp Het probably null 05/23/2013
78 267317 UTSW 5430419D17Rik R3439 G1 225 Y 7 131188779 T C critical splice donor site 2 bp Het probably null 02/18/2015
79 370013 UTSW 5730522E02Rik R4818 G1 225 Y 11 25770472 A G critical splice donor site 2 bp Het probably null 02/04/2016
80 383214 UTSW 5730522E02Rik R4942 G1 225 N 11 25770472 A G critical splice donor site 2 bp Het probably null 04/27/2016
81 105156 APN 5830415F09Rik IGL01722 G1 4 46386092 A G critical splice donor site 2 bp Het probably null 01/21/2014
82 267631 UTSW 6330416G13Rik R3196 G1 225 N 4 63577912 G A critical splice donor site 1 bp Het probably null 02/18/2015
83 307722 UTSW 9030617O03Rik R3946 G1 159 Y 12 100838700 T C critical splice donor site 2 bp Het probably null 04/17/2015
84 1445 APN 9030624J02Rik IGL00159 G1 7 118797047 G A critical splice donor site 1 bp Het probably null 07/12/2011
85 8495 APN 9130011E15Rik IGL00788 G1 19 45932350 C T critical splice donor site 1 bp Het probably null 0.000 12/06/2012
86 163571 UTSW 9130011E15Rik R1487 G1 225 N 19 45940443 A C critical splice donor site 2 bp Het probably null 03/28/2014
87 243965 UTSW 9130011E15Rik R2263 G1 225 Y 19 45932349 A G critical splice donor site 2 bp Het probably null 10/16/2014
88 177594 UTSW 9130401M01Rik R1587 G1 152 N 15 58028612 *200Q A G critical splice donor site Het probably null 04/24/2014
89 42617 UTSW 9330182L06Rik R0494 G1 225 Y 5 9420723 G A critical splice donor site 1 bp Het probably null 05/23/2013
90 100452 UTSW 9430015G10Rik R1162 G1 225 Y 4 156122418 T C critical splice donor site 2 bp Het probably null 01/15/2014
91 174588 UTSW 9430016H08Rik R1620 G1 225 Y 1 57409985 T C critical splice donor site 2 bp Het probably null 04/24/2014
92 404600 UTSW 9930021J03Rik R5306 G1 225 Y 19 29729830 A G critical splice donor site 2 bp Het probably null 07/22/2016
93 101243 UTSW A1bg R1199 G1 225 Y 15 60919635 A T critical splice donor site 2 bp Het probably null 01/15/2014
94 311548 UTSW A1cf R4007 G1 225 Y 19 31918124 T C critical splice donor site 2 bp Het probably null phenotype 04/29/2015
95 73767 APN A2m IGL01313 G1 6 121645010 T C critical splice donor site 2 bp Het probably null phenotype 10/07/2013
96 258011 UTSW A2m R0147 G1 63 Y 6 121662446 T C critical splice donor site 2 bp Het probably null phenotype 01/14/2015
97 60875 UTSW A2m R0148 G1 216 N 6 121662446 T C critical splice donor site 2 bp Het probably null phenotype 07/24/2013
98 476798 UTSW A330087D11Rik R2857 G1 225 N 7 29573878 A T critical splice donor site Het unknown 05/15/2017
99 370978 UTSW A3galt2 R4810 G1 182 Y 4 128755563 T C critical splice donor site 2 bp Het probably null phenotype 02/04/2016
100 405986 UTSW A430078G23Rik R5319 G1 225 Y 8 3385010 T C critical splice donor site 2 bp Het probably null 07/22/2016
[records 1 to 100 of 5541] next >> last >|