Incidental Mutations

9,592 incidental mutations are currently displayed, and affect 5,951 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
214 are Probably Benign.
9,334 are Probably Null.
0 create premature stop codons.
9,592 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 9592] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 46973 UTSW 0610009O20Rik 0.193 R0511 G1 225 Y 18 38254071 T C critical splice donor site 2 bp Het probably null 0.532 06/11/2013
2 326976 UTSW 0610009O20Rik 0.193 R4418 G1 225 Y 18 38261287 T C critical splice donor site 2 bp Het probably null 0.614 07/07/2015
3 89459 APN 0610010F05Rik 0.197 IGL01522 G1 11 23582865 A G critical splice donor site 2 bp Het probably null 12/03/2013
4 396740 UTSW 0610010F05Rik 0.197 R5156 G1 225 Y 11 23593424 A G critical splice donor site 2 bp Het probably null 0.466 06/21/2016
5 227312 UTSW 1110017D15Rik 0.069 R2073 G1 225 N 4 41507519 A G critical splice donor site 2 bp Het probably null phenotype 09/17/2014
6 266808 UTSW 1500009L16Rik 0.071 R3416 G1 225 Y 10 83759632 T C critical splice donor site 2 bp Het probably null 0.494 02/18/2015
7 26834 APN 1500012F01Rik IGL00903 G1 2 167065486 G T critical splice donor site 6 bp Het probably benign 04/17/2013
8 51166 APN 1700007G11Rik 0.142 IGL01133 G1 5 98498381 T C critical splice donor site 2 bp Het probably null 06/21/2013
9 29378 APN 1700010I14Rik 0.034 IGL00988 G1 17 8997105 T C critical splice donor site 2 bp Het probably null 04/17/2013
10 42078 UTSW 1700010I14Rik 0.034 R0482 G1 225 Y 17 8988423 T C critical splice donor site 2 bp Het probably null 0.522 05/23/2013
11 304149 APN 1700015F17Rik 0.184 IGL02701 5 5466623 A G critical splice donor site 2 bp Het probably null 04/16/2015
12 265174 UTSW 1700015F17Rik 0.184 R3056 G1 225 N 5 5457283 A T critical splice donor site 2 bp Het probably null 02/05/2015
13 542224 UTSW 1700017D01Rik 0.069 R6970 G1 225.01 N 19 11112314 A G critical splice donor site 2 bp Het probably null 11/28/2018
14 298525 APN 1700017N19Rik 0.053 IGL02556 10 100610717 T G critical splice donor site 2 bp Het probably null 04/16/2015
15 304113 APN 1700018B08Rik 0.038 IGL02700 8 121535422 C A critical splice donor site 1 bp Het probably null 04/16/2015
16 539586 UTSW 1700018B08Rik 0.038 R6920 G1 225.01 N 8 121535421 A G critical splice donor site 2 bp Het probably null 11/06/2018
17 311460 UTSW 1700021F07Rik 0.043 R4006 G1 225 N 2 173526087 T C critical splice donor site 2 bp Het probably null 04/29/2015
18 231555 UTSW 1700021P04Rik 0.081 R2087 G1 147 Y 19 24065000 T A critical splice donor site Het noncoding transcript 09/18/2014
19 104905 APN 1700030K09Rik 0.027 IGL01714 G1 8 72455569 T C critical splice donor site 2 bp Het probably null 01/21/2014
20 415371 APN 1700037H04Rik IGL03274 2 131153592 A T critical splice donor site 2 bp Het probably null 08/02/2016
21 512406 UTSW 1700061G19Rik 0.155 R6357 G1 170.01 N 17 56877591 T C critical splice donor site 2 bp Het probably null 04/27/2018
22 151721 UTSW 1700074P13Rik 0.036 R1250 G1 225 N 6 40925975 A T critical splice donor site 2 bp Het probably null 01/29/2014
23 440288 UTSW 1700123K08Rik 0.020 R5610 G1 225 N 5 138564141 A G critical splice donor site 2 bp Het probably null 11/08/2016
24 456485 UTSW 1810062G17Rik 0.087 R5905 G1 225 N 3 36479569 T A critical splice donor site 2 bp Het probably null 0.611 02/15/2017
25 480155 UTSW 1810062G17Rik 0.087 R6028 G1 225.01 Y 3 36479569 T A critical splice donor site 2 bp Het probably null 0.611 06/26/2017
26 234841 UTSW 1810065E05Rik 0.196 R2156 G1 225 N 11 58422308 T A critical splice donor site 2 bp Het probably null 10/01/2014
27 393810 UTSW 2010315B03Rik 0.122 R5110 G1 225 Y 9 124295357 C A critical splice donor site 1 bp Het probably null 0.638 06/15/2016
28 105226 APN 2200002D01Rik 0.075 IGL01724 G1 7 29247896 C T critical splice donor site 1 bp Het probably null 01/21/2014
29 374679 UTSW 2210407C18Rik 0.083 R4863 G1 225 Y 11 58612512 A T critical splice donor site 2 bp Het probably null 0.625 03/17/2016
30 407576 APN 2210408I21Rik 0.343 IGL03006 13 77323772 T C critical splice donor site 2 bp Het probably null 08/02/2016
31 326282 UTSW 2210408I21Rik 0.343 R4387 G1 225 N 13 77316574 T A critical splice donor site 2 bp Het probably null 0.428 07/06/2015
32 326316 UTSW 2210408I21Rik 0.343 R4388 G1 225 Y 13 77316574 T A critical splice donor site 2 bp Het probably null 0.428 07/06/2015
33 203614 UTSW 2310011J03Rik 0.054 R1808 G1 225 N 10 80320181 A G critical splice donor site 2 bp Het probably null 06/23/2014
34 506986 UTSW 2310035C23Rik 0.431 R6266 G1 225.01 N 1 105731282 T G critical splice donor site 2 bp Het probably null 03/15/2018
35 472880 UTSW 2310057J18Rik 0.062 R4801 G1 225 N 10 28983926 A G critical splice donor site 2 bp Het probably null 0.506 04/14/2017
36 370313 UTSW 2310057J18Rik 0.062 R4802 G1 225 Y 10 28983926 A G critical splice donor site 2 bp Het probably null 0.506 02/04/2016
37 436180 UTSW 2410004B18Rik 0.290 R5545 G1 225 N 3 145939098 T C critical splice donor site 2 bp Het probably null 10/24/2016
38 383621 UTSW 2610318N02Rik 0.093 R4948 G1 127 Y 16 17118290 A T critical splice donor site 2 bp Het probably null 0.656 04/27/2016
39 272395 UTSW 2610507B11Rik 0.950 R3788 G1 225 Y 11 78288297 T A critical splice donor site 2 bp Het probably null 0.468 03/25/2015
40 186200 UTSW 2610524H06Rik R1571 G1 220 N 5 114823311 A G critical splice donor site 2 bp Het probably null 05/09/2014
41 52457 APN 2700049A03Rik 1.000 IGL01107 G1 12 71194468 T C critical splice donor site 2 bp Het probably null phenotype 06/21/2013
42 33807 UTSW 2700049A03Rik 1.000 R0220 G1 140 N 12 71148420 T C critical splice donor site 2 bp Het probably null phenotype 05/09/2013
43 489804 UTSW 2810474O19Rik 0.000 R6160 G1 225.01 Y 6 149331507 G A critical splice donor site 1 bp Het probably null 10/10/2017
44 324513 UTSW 2900026A02Rik 0.068 R4329 G1 186 Y 5 113095589 C A critical splice donor site 1 bp Het probably null 0.574 06/24/2015
45 504531 UTSW 3110009E18Rik 0.051 R6229 G1 219.01 Y 1 120171483 G A critical splice donor site 1 bp Het probably null 02/28/2018
46 314218 UTSW 3110070M22Rik 0.093 R4052 176 N 13 119488202 T G critical splice donor site 2 bp Het probably null 04/30/2015
47 439494 UTSW 4430402I18Rik 0.109 R4911 G1 225 Y 19 28897503 G A critical splice donor site Het probably benign 0.068 11/02/2016
48 191138 UTSW 4732465J04Rik 0.250 R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Het probably null 05/14/2014
49 89778 APN 4833420G17Rik 0.218 IGL01531 G1 13 119466958 T A critical splice donor site 2 bp Het probably null 12/03/2013
50 249919 UTSW 4833427G06Rik 0.068 R2444 G1 225 N 9 51099998 A G critical splice donor site 2 bp Het probably null 11/12/2014
51 153057 APN 4833439L19Rik 0.232 IGL01747 G1 13 54556525 A G critical splice donor site 2 bp Het probably null 02/04/2014
52 161756 UTSW 4921504E06Rik 0.030 R1456 G1 225 Y 2 19480920 C T critical splice donor site 1 bp Het probably null 0.602 03/14/2014
53 432623 UTSW 4921507P07Rik 0.119 R5453 G1 225 N 6 50595796 A G critical splice donor site 2 bp Het probably null 10/06/2016
54 527886 UTSW 4921507P07Rik 0.119 R6689 G1 225.01 N 6 50589109 A G critical splice donor site 2 bp Het probably null 07/23/2018
55 274885 UTSW 4921524L21Rik 0.093 R3820 G1 225 Y 18 6630166 G T critical splice donor site 1 bp Het probably null 0.530 04/02/2015
56 455349 UTSW 4921524L21Rik 0.093 R5873 G1 225 N 18 6630167 T A critical splice donor site 2 bp Het probably null 02/10/2017
57 525369 UTSW 4921539E11Rik 0.012 R6634 G1 225.01 N 4 103236930 C T critical splice donor site 1 bp Het probably null 06/22/2018
58 50633 APN 4930402H24Rik 0.225 IGL01146 G1 2 130770671 C T critical splice donor site 1 bp Het probably null phenotype 06/21/2013
59 163374 UTSW 4930402H24Rik 0.225 R1485 G1 211 N 2 130748683 A G critical splice donor site 2 bp Het probably null phenotype 03/28/2014
60 530095 UTSW 4930402H24Rik 0.225 R6732 G1 225.01 N 2 130810820 A G critical splice donor site 2 bp Het probably null phenotype 08/01/2018
61 297010 APN 4930415O20Rik 0.166 IGL02524 15 98571125 G A critical splice donor site 1 bp Het probably null 04/16/2015
62 57037 UTSW 4930430A15Rik 0.036 R0645 G1 159 Y 2 111214583 C T critical splice donor site 1 bp Het probably null 0.610 07/11/2013
63 200914 UTSW 4930430A15Rik 0.036 R1464 G1 225 N 2 111225403 A G critical splice donor site 2 bp Het probably null 05/23/2014
64 512672 UTSW 4930430A15Rik 0.036 R6366 G1 225.01 N 2 111169592 A G critical splice donor site 2 bp Het probably null 0.601 04/27/2018
65 542764 UTSW 4930430A15Rik 0.036 R6983 G1 225.01 N 2 111228250 A G critical splice donor site 2 bp Het probably null 11/28/2018
66 389692 UTSW 4930444P10Rik 0.093 R4999 G1 225 N 1 16068798 A G critical splice donor site 2 bp Het probably null 06/06/2016
67 401005 UTSW 4930447C04Rik 0.288 R5243 G1 225 Y 12 72909769 A T critical splice donor site 2 bp Het probably null 0.474 phenotype 07/06/2016
68 432728 UTSW 4930452B06Rik 0.115 R5455 G1 225 N 14 8536516 A T critical splice donor site 2 bp Het probably null 10/06/2016
69 288146 APN 4930467E23Rik IGL02318 8 19747799 T C critical splice donor site 2 bp Het probably null 04/16/2015
70 251724 UTSW 4930510E17Rik 0.194 R2847 G1 225 N 9 53264789 T C critical splice donor site Het noncoding transcript 12/04/2014
71 162048 UTSW 4930522H14Rik 0.037 R1460 G1 225 Y 4 109531210 A T critical splice donor site 2 bp Het probably null 0.520 03/14/2014
72 382049 UTSW 4930522L14Rik 0.139 R4952 G1 225 Y 5 109739197 A G critical splice donor site 2 bp Het probably null 0.611 04/27/2016
73 396515 UTSW 4930522L14Rik 0.139 R5143 G1 212 N 5 109739198 C T critical splice donor site 1 bp Het probably null 06/21/2016
74 501380 UTSW 4930579C12Rik 0.148 R5756 G1 133 Y 9 89128866 A G critical splice donor site Het noncoding transcript 0.060 12/01/2017
75 234249 UTSW 4930579F01Rik 0.054 R2151 G1 225 Y 3 138176456 A G critical splice donor site 2 bp Het probably null 0.546 10/01/2014
76 54554 UTSW 4930596D02Rik 0.242 R0609 G1 225 N 14 35811461 A T critical splice donor site 2 bp Het probably null 07/11/2013
77 516839 UTSW 4931406P16Rik 0.243 R6477 G1 225.01 Y 7 34257630 A G critical splice donor site 2 bp Het probably null 05/21/2018
78 267531 UTSW 4931409K22Rik 0.141 R3522 G1 225 Y 5 24549626 A G critical splice donor site 2 bp Het probably null 0.631 02/18/2015
79 367659 UTSW 4931409K22Rik 0.141 R4773 G1 225 Y 5 24550598 A G critical splice donor site 2 bp Het probably null 0.580 12/29/2015
80 326435 UTSW 4931414P19Rik 0.102 R4392 G1 225 Y 14 54584978 C T critical splice donor site 1 bp Het probably null 0.660 07/06/2015
81 439685 UTSW 4931423N10Rik 0.068 R5619 G1 225 Y 2 23257005 T C critical splice donor site 2 bp Het probably null 0.632 11/08/2016
82 396289 UTSW 4931429L15Rik 0.239 R5138 G1 225 Y 9 46306821 C A critical splice donor site 1 bp Het probably null 0.630 06/21/2016
83 427931 UTSW 4931429L15Rik 0.239 R5419 G1 225 N 9 46309326 C T critical splice donor site 1 bp Het probably null 09/01/2016
84 307848 UTSW 4932414N04Rik 0.073 R3950 G1 225 N 2 68664403 T C critical splice donor site 2 bp Het probably null 0.610 04/17/2015
85 307917 UTSW 4932414N04Rik 0.073 R3951 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 0.610 04/17/2015
86 307973 UTSW 4932414N04Rik 0.073 R3952 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 0.610 04/17/2015
87 78785 APN 4932438A13Rik 0.862 IGL01377 G1 3 36973452 T C critical splice donor site 2 bp Het probably null phenotype 11/05/2013
88 286293 APN 4932438A13Rik 0.862 IGL02248 3 36969290 T C critical splice donor site 2 bp Het probably null phenotype 04/16/2015
89 222613 UTSW 4932438A13Rik 0.862 R1987 G1 225 N 3 36953985 T A critical splice donor site 2 bp Het probably null phenotype 08/25/2014
90 241406 UTSW 4932438A13Rik 0.862 R2220 G1 225 N 3 36875530 T C critical splice donor site 2 bp Het probably null phenotype 10/15/2014
91 378756 UTSW 5330417C22Rik 0.165 R4923 G1 225 Y 3 108471968 C T critical splice donor site 1 bp Het probably null 0.674 phenotype 04/15/2016
92 527136 UTSW 5430401F13Rik 0.122 R6671 G1 225.01 N 6 131551350 T C critical splice donor site 2 bp Het probably null 07/23/2018
93 297896 APN 5430403G16Rik 0.127 IGL02547 5 109678762 C T critical splice donor site 1 bp Het probably null 04/16/2015
94 418431 APN 5430419D17Rik 0.044 IGL03092 7 131201798 G T critical splice donor site 1 bp Het probably null 08/02/2016
95 267317 UTSW 5430419D17Rik 0.044 R3439 G1 225 Y 7 131188779 T C critical splice donor site 2 bp Het probably null 0.637 02/18/2015
96 510346 UTSW 5430419D17Rik 0.044 R6321 G1 225.01 Y 7 131257006 T C critical splice donor site 2 bp Het probably null 04/02/2018
97 518590 UTSW 5430419D17Rik 0.044 R6432 G1 225.01 Y 7 131244872 G A critical splice donor site 1 bp Het probably null 05/24/2018
98 370013 UTSW 5730522E02Rik 0.104 R4818 G1 225 Y 11 25770472 A G critical splice donor site 2 bp Het probably null 0.641 02/04/2016
99 383214 UTSW 5730522E02Rik 0.104 R4942 G1 225 N 11 25770472 A G critical splice donor site 2 bp Het probably null 0.641 04/27/2016
100 508742 UTSW 5730559C18Rik 0.119 R6296 G1 225.01 N 1 136221071 C T critical splice donor site 1 bp Het probably null 04/02/2018
[records 1 to 100 of 9592] next >> last >|