Incidental Mutations

4,983 incidental mutations are currently displayed, and affect 3,518 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
5 are Probably Benign.
4,688 are Probably Null.
0 create premature stop codons.
4,983 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 4983] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
MGI Phenotype question?
Posted question?
 
1 46973 UTSW 0610009O20Rik R0511 G1 225 Y 18 38254071 T C critical splice donor site 2 bp Het probably null 06/11/2013
2 396740 UTSW 0610010F05Rik R5156 G1 225 Y 11 23593424 A G critical splice donor site 2 bp Het probably null 06/21/2016
3 227312 UTSW 1110017D15Rik R2073 G1 225 N 4 41507519 A G critical splice donor site 2 bp Het probably null 09/17/2014
4 48619 UTSW 1110037F02Rik R0522 G1 214 Y 4 11519416 T C critical splice donor site 2 bp Het probably null 06/12/2013
5 266808 UTSW 1500009L16Rik R3416 G1 225 Y 10 83759632 T C critical splice donor site 2 bp Het probably null 02/18/2015
6 384609 UTSW 1700008F21Rik R4978 G1 225 Y 8 129110207 T C critical splice donor site 2 bp Het probably null 05/10/2016
7 42078 UTSW 1700010I14Rik R0482 G1 225 Y 17 8988423 T C critical splice donor site 2 bp Het probably null 05/23/2013
8 265174 UTSW 1700015F17Rik R3056 G1 225 N 5 5457283 A T critical splice donor site 2 bp Het probably null 02/05/2015
9 311460 UTSW 1700021F07Rik R4006 G1 225 N 2 173526087 T C critical splice donor site 2 bp Het probably null 04/29/2015
10 367277 UTSW 1700021K19Rik R4788 G1 107 N 16 32836408 A G critical splice donor site 2 bp Het probably null 12/29/2015
11 231555 UTSW 1700021P04Rik R2087 G1 147 Y 19 24065000 T A critical splice donor site Het noncoding transcript 09/18/2014
12 432519 UTSW 1700039E15Rik R5485 G1 225 Y 7 45282542 G A critical splice donor site 1 bp Het probably null 10/05/2016
13 151721 UTSW 1700074P13Rik R1250 G1 225 N 6 40925975 A T critical splice donor site 2 bp Het probably null 01/29/2014
14 480155 UTSW 1810062G17Rik R6028 G1 225.01 N 3 36479569 T A critical splice donor site 2 bp Het probably null 06/26/2017
15 234841 UTSW 1810065E05Rik R2156 G1 225 N 11 58422308 T A critical splice donor site 2 bp Het probably null 10/01/2014
16 76691 UTSW 2310003H01Rik R0782 G1 218 Y 11 120376704 A G critical splice donor site 2 bp Het probably null 10/16/2013
17 203614 UTSW 2310011J03Rik R1808 G1 225 N 10 80320181 A G critical splice donor site 2 bp Het probably null 06/23/2014
18 472880 UTSW 2310057J18Rik R4801 G1 225 N 10 28983926 A G critical splice donor site 2 bp Het probably null 04/14/2017
19 370313 UTSW 2310057J18Rik R4802 G1 225 Y 10 28983926 A G critical splice donor site 2 bp Het probably null 02/04/2016
20 174282 UTSW 2310067B10Rik R1616 G1 208 N 11 115796145 T C critical splice donor site 2 bp Het probably null 04/24/2014
21 38454 UTSW 2610020H08Rik R0347 G1 225 Y 7 119823896 T A critical splice donor site 2 bp Het probably null 05/23/2013
22 201065 UTSW 2610020H08Rik R1465 G1 215 N 7 119801358 T A critical splice donor site 2 bp Het probably null 05/23/2014
23 383621 UTSW 2610318N02Rik R4948 G1 127 Y 16 17118290 A T critical splice donor site 2 bp Het probably null 04/27/2016
24 272395 UTSW 2610507B11Rik R3788 G1 225 Y 11 78288297 T A critical splice donor site 2 bp Het probably null 03/25/2015
25 33807 UTSW 2700049A03Rik R0220 G1 140 N 12 71148420 T C critical splice donor site 2 bp Het probably null phenotype 05/09/2013
26 489804 UTSW 2810474O19Rik R6160 G1 225.01 N 6 149331507 G A critical splice donor site 1 bp Het probably null 10/10/2017
27 248884 UTSW 4732456N10Rik R2404 G1 225 Y 15 101554670 A G critical splice donor site 2 bp Het probably null 11/11/2014
28 191306 UTSW 4732465J04Rik R1719 G1 167 N 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Homo probably null 05/14/2014
29 247355 UTSW 4732465J04Rik R2312 G1 126 N 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Homo probably null 11/11/2014
30 249919 UTSW 4833427G06Rik R2444 G1 225 N 9 51099998 A G critical splice donor site 2 bp Het probably null 11/12/2014
31 161756 UTSW 4921504E06Rik R1456 G1 225 Y 2 19480920 C T critical splice donor site 1 bp Het probably null 03/14/2014
32 274885 UTSW 4921524L21Rik R3820 G1 225 Y 18 6630166 G T critical splice donor site 1 bp Het probably null 04/02/2015
33 455349 UTSW 4921524L21Rik R5873 G1 225 N 18 6630167 T A critical splice donor site 2 bp Het probably null 02/10/2017
34 158342 UTSW 4921528O07Rik R1301 G1 225 Y 1 163043983 C T critical splice donor site 1 bp Het probably null 02/18/2014
35 163374 UTSW 4930402H24Rik R1485 G1 211 N 2 130748683 A G critical splice donor site 2 bp Het probably null 03/28/2014
36 57037 UTSW 4930430A15Rik R0645 G1 159 Y 2 111214583 C T critical splice donor site 1 bp Het probably null 07/11/2013
37 200914 UTSW 4930430A15Rik R1464 G1 225 N 2 111225403 A G critical splice donor site 2 bp Het probably null 05/23/2014
38 389692 UTSW 4930444P10Rik R4999 G1 225 N 1 16068798 A G critical splice donor site 2 bp Het probably null 06/06/2016
39 251724 UTSW 4930510E17Rik R2847 G1 225 N 9 53264789 T C critical splice donor site Het noncoding transcript 12/04/2014
40 162048 UTSW 4930522H14Rik R1460 G1 225 Y 4 109531210 A T critical splice donor site 2 bp Het probably null 03/14/2014
41 382049 UTSW 4930522L14Rik R4952 G1 225 Y 5 109739197 A G critical splice donor site 2 bp Het probably null 04/27/2016
42 396515 UTSW 4930522L14Rik R5143 G1 212 N 5 109739198 C T critical splice donor site 1 bp Het probably null 06/21/2016
43 66370 UTSW 4930527J03Rik R0294 G1 111 N 1 178276503 ACCC ACC critical splice donor site Het noncoding transcript 08/19/2013
44 66437 UTSW 4930527J03Rik R0323 G1 105 N 1 178276503 ACCC ACC critical splice donor site Het noncoding transcript 08/19/2013
45 66460 UTSW 4930527J03Rik R0392 G1 107 N 1 178276503 ACCC ACC critical splice donor site Het noncoding transcript 08/19/2013
46 95821 UTSW 4930527J03Rik R1013 G1 109 Y 1 178276503 ACCC ACC critical splice donor site Homo noncoding transcript 01/05/2014
47 152164 UTSW 4930527J03Rik R1247 G1 196 N 1 178276503 ACCC ACC critical splice donor site Homo noncoding transcript 01/29/2014
48 203200 UTSW 4930538K18Rik R1802 G1 225 N 4 119210873 A T critical splice donor site 2 bp Het probably null 06/23/2014
49 204369 UTSW 4930562C15Rik R1775 G1 225 Y 16 4851558 G A critical splice donor site 1 bp Het probably null 06/23/2014
50 234249 UTSW 4930579F01Rik R2151 G1 225 Y 3 138176456 A G critical splice donor site 2 bp Het probably null 10/01/2014
51 54554 UTSW 4930596D02Rik R0609 G1 225 N 14 35811461 A T critical splice donor site 2 bp Het probably null 07/11/2013
52 267531 UTSW 4931409K22Rik R3522 G1 225 Y 5 24549626 A G critical splice donor site 2 bp Het probably null 02/18/2015
53 439685 UTSW 4931423N10Rik R5619 G1 225 Y 2 23257005 T C critical splice donor site 2 bp Het probably null 11/08/2016
54 396289 UTSW 4931429L15Rik R5138 G1 225 Y 9 46306821 C A critical splice donor site 1 bp Het probably null 06/21/2016
55 491657 UTSW 4932414N04Rik JAX1 G1 278.2 N 2 68664403 T C critical splice donor site 2 bp Het probably null 11/21/2017
56 307848 UTSW 4932414N04Rik R3950 G1 225 N 2 68664403 T C critical splice donor site 2 bp Het probably null 04/17/2015
57 307917 UTSW 4932414N04Rik R3951 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 04/17/2015
58 307973 UTSW 4932414N04Rik R3952 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 04/17/2015
59 222613 UTSW 4932438A13Rik R1987 G1 225 N 3 36953985 T A critical splice donor site 2 bp Het probably null 08/25/2014
60 241406 UTSW 4932438A13Rik R2220 G1 225 N 3 36875530 T C critical splice donor site 2 bp Het probably null 10/15/2014
61 234431 UTSW 4932441B19Rik R2152 G1 225 N 13 65033965 G A critical splice donor site 1 bp Het probably null 10/01/2014
62 249900 UTSW 4933406J08Rik R2444 G1 225 N 2 122193307 T A critical splice donor site 2 bp Het probably null 11/12/2014
63 214371 UTSW 4933424B01Rik R1906 G1 225 N 6 146552370 A T critical splice donor site 2 bp Het probably null 07/14/2014
64 40220 UTSW 4933427G23Rik R0415 G1 215 N 5 23831050 A T critical splice donor site Het noncoding transcript 05/23/2013
65 267317 UTSW 5430419D17Rik R3439 G1 225 Y 7 131188779 T C critical splice donor site 2 bp Het probably null 02/18/2015
66 370013 UTSW 5730522E02Rik R4818 G1 225 Y 11 25770472 A G critical splice donor site 2 bp Het probably null 02/04/2016
67 383214 UTSW 5730522E02Rik R4942 G1 225 N 11 25770472 A G critical splice donor site 2 bp Het probably null 04/27/2016
68 267631 UTSW 6330416G13Rik R3196 G1 225 N 4 63577912 G A critical splice donor site 1 bp Het probably null 02/18/2015
69 307722 UTSW 9030617O03Rik R3946 G1 159 Y 12 100838700 T C critical splice donor site 2 bp Het probably null 04/17/2015
70 163571 UTSW 9130011E15Rik R1487 G1 225 N 19 45940443 A C critical splice donor site 2 bp Het probably null 03/28/2014
71 243965 UTSW 9130011E15Rik R2263 G1 225 Y 19 45932349 A G critical splice donor site 2 bp Het probably null 10/16/2014
72 177594 UTSW 9130401M01Rik R1587 G1 152 N 15 58028612 *200Q A G critical splice donor site Het probably null 04/24/2014
73 42617 UTSW 9330182L06Rik R0494 G1 225 Y 5 9420723 G A critical splice donor site 1 bp Het probably null 05/23/2013
74 100452 UTSW 9430015G10Rik R1162 G1 225 Y 4 156122418 T C critical splice donor site 2 bp Het probably null 01/15/2014
75 174588 UTSW 9430016H08Rik R1620 G1 225 Y 1 57409985 T C critical splice donor site 2 bp Het probably null 04/24/2014
76 404600 UTSW 9930021J03Rik R5306 G1 225 Y 19 29729830 A G critical splice donor site 2 bp Het probably null 07/22/2016
77 101243 UTSW A1bg R1199 G1 225 Y 15 60919635 A T critical splice donor site 2 bp Het probably null 01/15/2014
78 311548 UTSW A1cf R4007 G1 225 Y 19 31918124 T C critical splice donor site 2 bp Het probably null phenotype 04/29/2015
79 258011 UTSW A2m R0147 G1 63 Y 6 121662446 T C critical splice donor site 2 bp Het probably null phenotype 01/14/2015
80 60875 UTSW A2m R0148 G1 216 N 6 121662446 T C critical splice donor site 2 bp Het probably null phenotype 07/24/2013
81 476798 UTSW A330087D11Rik R2857 G1 225 N 7 29573878 A T critical splice donor site Het noncoding transcript 05/15/2017
82 370978 UTSW A3galt2 R4810 G1 182 Y 4 128755563 T C critical splice donor site 2 bp Het probably null phenotype 02/04/2016
83 405986 UTSW A430078G23Rik R5319 G1 225 Y 8 3385010 T C critical splice donor site 2 bp Het probably null 07/22/2016
84 244035 UTSW A830018L16Rik R2265 G1 225 N 1 11972104 T C critical splice donor site 2 bp Het probably null 10/16/2014
85 430931 UTSW A930009A15Rik R5506 G1 225 Y 10 115578362 G T critical splice donor site 1 bp Het probably null 10/05/2016
86 36850 UTSW A930018P22Rik R0418 G1 214 Y 2 104123330 G T critical splice donor site 1 bp Het probably null 05/09/2013
87 486803 UTSW A930033H14Rik R5241 G1 225 N 10 69212751 A G critical splice donor site 2 bp Het probably null 08/17/2017
88 192871 UTSW AA986860 R1762 G1 225 N 1 130737688 G A critical splice donor site 1 bp Het probably null 05/23/2014
89 438763 UTSW Aaas R5586 G1 225 Y 15 102346676 A T critical splice donor site 2 bp Het probably null phenotype 10/26/2016
90 198064 UTSW Aacs R1725 G1 225 N 5 125482935 T C critical splice donor site 2 bp Het probably null 05/23/2014
91 217066 UTSW Aadac R1964 G1 225 N 3 60037338 T A critical splice donor site 2 bp Het probably null 08/01/2014
92 376782 UTSW Aadat R4874 G1 225 Y 8 60516113 G A critical splice donor site 1 bp Het probably null phenotype 03/17/2016
93 211349 UTSW Aars2 R1878 G1 163 N 17 45514638 G A critical splice donor site 1 bp Het probably null 06/30/2014
94 44822 UTSW Aass R0546 G1 225 Y 6 23077077 A G critical splice donor site 2 bp Het probably null 06/11/2013
95 26373 UTSW Aatf R0324 G1 225 N 11 84512139 A G critical splice donor site 2 bp Het probably null phenotype 04/16/2013
96 93764 UTSW Abca12 R1036 G1 167 Y 1 71263410 A G critical splice donor site 2 bp Het probably null phenotype 01/05/2014
97 187964 UTSW Abca12 R1675 G1 225 N 1 71263411 C T critical splice donor site 1 bp Het probably null phenotype 05/09/2014
98 49610 UTSW Abca13 R0538 G1 225 Y 11 9267622 G A critical splice donor site 1 bp Het probably null 06/12/2013
99 377570 UTSW Abca14 R4895 G1 225 Y 7 120247349 G A critical splice donor site 1 bp Het probably null 03/17/2016
100 31351 UTSW Abca15 R0387 G1 225 Y 7 120332852 T G critical splice donor site 2 bp Het probably null 04/24/2013
[records 1 to 100 of 4983] next >> last >|